Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0620020791:

Variant ID: vg0620020791 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 20020791
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.90, A: 0.10, others allele: 0.00, population size: 81. )

Flanking Sequence (100 bp) in Reference Genome:

CCACCGTGGCGGGCGCCGTCGCCGTCGCGGTCGCGCTCCTCCTGCTGGCGCTCGCCGGCAGGCTGGCGCAGACGACGGGAGGAGGCTCCGCCGCGGCGGC[G/A]
GCGTCGGGGCGGCGGCGGCGGCTGCTGAGCTGCCCGTGCGCGTGCGGGCTGATGGCGCCCGGCGCGGGGGGGATCGGCGTGCTGCCGGCGTTCGCGTACG

Reverse complement sequence

CGTACGCGAACGCCGGCAGCACGCCGATCCCCCCCGCGCCGGGCGCCATCAGCCCGCACGCGCACGGGCAGCTCAGCAGCCGCCGCCGCCGCCCCGACGC[C/T]
GCCGCCGCGGCGGAGCCTCCTCCCGTCGTCTGCGCCAGCCTGCCGGCGAGCGCCAGCAGGAGGAGCGCGACCGCGACGGCGACGGCGCCCGCCACGGTGG

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	58.00%	16.90%	18.71%	6.39%	NA
All Indica	2759	83.30%	1.60%	11.74%	3.44%	NA
All Japonica	1512	4.50%	46.60%	35.38%	13.56%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	71.10%	1.50%	23.53%	3.87%	NA
Indica II	465	71.80%	2.40%	17.63%	8.17%	NA
Indica III	913	98.80%	0.50%	0.44%	0.22%	NA
Indica Intermediate	786	81.20%	2.30%	12.47%	4.07%	NA
Temperate Japonica	767	2.70%	29.50%	49.15%	18.64%	NA
Tropical Japonica	504	7.50%	58.50%	23.61%	10.32%	NA
Japonica Intermediate	241	3.70%	75.90%	16.18%	4.15%	NA
VI/Aromatic	96	64.60%	34.40%	1.04%	0.00%	NA
Intermediate	90	48.90%	22.20%	26.67%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0620020791	G -> A	LOC_Os06g34400.1	synonymous_variant ; p.Ala314Ala; LOW	synonymous_codon	Average:90.147; most accessible tissue: Minghui63 panicle, score: 98.021	N	N	N	N
vg0620020791	G -> A	LOC_Os06g34400.1	synonymous_variant ; p.Ala314Ala; LOW	nonsynonymous_codon ; A314E	Average:90.147; most accessible tissue: Minghui63 panicle, score: 98.021	unknown	unknown	DELETERIOUS	0.01
vg0620020791	G -> DEL	LOC_Os06g34400.1	N	frameshift_variant	Average:90.147; most accessible tissue: Minghui63 panicle, score: 98.021	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0620020791	G	A	-0.02	-0.04	-0.03	-0.02	-0.01	0.0