Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0619779165:

Variant ID: vg0619779165 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 19779165
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ACCCCCTGCCCCACACACTGCTATATTCCTAGTGGCCTCTGGCCGCCTCCACCTTGCTGATGGCTATTGTTAGCTCGCTACCGCTGCCTGTGTCTGCATC[G/A]
TCGTTGGGCTCGCCGCGTTCACCATTTCTTGTTTCAAACCACTCTCCCCCATGTAGATCTAGGGCGTGTTTCATGGAGTTGTCGTGTTCACCATTTCTTG

Reverse complement sequence

CAAGAAATGGTGAACACGACAACTCCATGAAACACGCCCTAGATCTACATGGGGGAGAGTGGTTTGAAACAAGAAATGGTGAACGCGGCGAGCCCAACGA[C/T]
GATGCAGACACAGGCAGCGGTAGCGAGCTAACAATAGCCATCAGCAAGGTGGAGGCGGCCAGAGGCCACTAGGAATATAGCAGTGTGTGGGGCAGGGGGT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 94.80% 5.20% 0.04% 0.00% NA
All Indica  2759 98.80% 1.20% 0.00% 0.00% NA
All Japonica  1512 86.10% 13.80% 0.13% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 98.70% 1.30% 0.00% 0.00% NA
Indica II  465 99.40% 0.60% 0.00% 0.00% NA
Indica III  913 99.70% 0.30% 0.00% 0.00% NA
Indica Intermediate  786 97.50% 2.50% 0.00% 0.00% NA
Temperate Japonica  767 77.30% 22.40% 0.26% 0.00% NA
Tropical Japonica  504 99.40% 0.60% 0.00% 0.00% NA
Japonica Intermediate  241 86.30% 13.70% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 97.80% 2.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0619779165 G -> A LOC_Os06g33950.1 upstream_gene_variant ; 4715.0bp to feature; MODIFIER silent_mutation Average:73.793; most accessible tissue: Minghui63 young leaf, score: 90.802 N N N N
vg0619779165 G -> A LOC_Os06g33960.1 upstream_gene_variant ; 3649.0bp to feature; MODIFIER silent_mutation Average:73.793; most accessible tissue: Minghui63 young leaf, score: 90.802 N N N N
vg0619779165 G -> A LOC_Os06g33970.1 upstream_gene_variant ; 1746.0bp to feature; MODIFIER silent_mutation Average:73.793; most accessible tissue: Minghui63 young leaf, score: 90.802 N N N N
vg0619779165 G -> A LOC_Os06g33980.1 downstream_gene_variant ; 3998.0bp to feature; MODIFIER silent_mutation Average:73.793; most accessible tissue: Minghui63 young leaf, score: 90.802 N N N N
vg0619779165 G -> A LOC_Os06g33980.2 downstream_gene_variant ; 3998.0bp to feature; MODIFIER silent_mutation Average:73.793; most accessible tissue: Minghui63 young leaf, score: 90.802 N N N N
vg0619779165 G -> A LOC_Os06g33960-LOC_Os06g33970 intergenic_region ; MODIFIER silent_mutation Average:73.793; most accessible tissue: Minghui63 young leaf, score: 90.802 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0619779165 G A 0.01 0.0 0.0 0.01 0.01 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0619779165 NA 1.74E-06 mr1006_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619779165 NA 1.75E-07 mr1057_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619779165 NA 1.06E-08 mr1062_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619779165 1.16E-06 4.58E-07 mr1127_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619779165 2.33E-06 2.33E-06 mr1127_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619779165 NA 2.22E-08 mr1167_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619779165 NA 2.78E-07 mr1456_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619779165 NA 1.76E-06 mr1565_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619779165 1.87E-06 NA mr1726_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619779165 NA 3.89E-08 mr1726_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619779165 NA 2.91E-06 mr1736_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619779165 NA 4.43E-06 mr1736_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619779165 NA 3.02E-06 mr1781_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251