\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).


Sorry, variation is wrong, please check.

Detailed information for vg0618798718:

Variant ID: vg0618798718 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 18798718
Reference Allele: GAlternative Allele: C
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTCGGCGTCCCAAGGTGTCTTGGTTCGTTCCGTCAATGCACTATCCCGACCGAACCAACATGGCACCCGGAGCACCTCGTATTATGTGATGAATTGATAA[G/C]
CTAGGAACTAAATCCATATATAAATGAATAATTATCAAAAAAATTACATATATACCACATATCCTATATCCCAAAAATCACAAAATTGACATATAAAAAA

Reverse complement sequence

TTTTTTATATGTCAATTTTGTGATTTTTGGGATATAGGATATGTGGTATATATGTAATTTTTTTGATAATTATTCATTTATATATGGATTTAGTTCCTAG[C/G]
TTATCAATTCATCACATAATACGAGGTGCTCCGGGTGCCATGTTGGTTCGGTCGGGATAGTGCATTGACGGAACGAACCAAGACACCTTGGGACGCCGAG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 80.70% 12.80% 1.12% 5.44% NA
All Indica  2759 96.50% 0.50% 0.22% 2.79% NA
All Japonica  1512 47.40% 38.40% 2.91% 11.31% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 95.50% 0.70% 0.00% 3.87% NA
Indica II  465 97.80% 0.90% 0.65% 0.65% NA
Indica III  913 98.40% 0.00% 0.11% 1.53% NA
Indica Intermediate  786 94.40% 0.60% 0.25% 4.71% NA
Temperate Japonica  767 24.10% 59.50% 3.78% 12.65% NA
Tropical Japonica  504 79.80% 11.30% 2.18% 6.75% NA
Japonica Intermediate  241 53.90% 27.80% 1.66% 16.60% NA
VI/Aromatic  96 92.70% 0.00% 1.04% 6.25% NA
Intermediate  90 82.20% 12.20% 2.22% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0618798718 G -> C LOC_Os06g32290.1 upstream_gene_variant ; 1488.0bp to feature; MODIFIER silent_mutation Average:33.027; most accessible tissue: Zhenshan97 young leaf, score: 50.669 N N N N
vg0618798718 G -> C LOC_Os06g32280.1 downstream_gene_variant ; 2253.0bp to feature; MODIFIER silent_mutation Average:33.027; most accessible tissue: Zhenshan97 young leaf, score: 50.669 N N N N
vg0618798718 G -> C LOC_Os06g32300.1 downstream_gene_variant ; 1364.0bp to feature; MODIFIER silent_mutation Average:33.027; most accessible tissue: Zhenshan97 young leaf, score: 50.669 N N N N
vg0618798718 G -> C LOC_Os06g32290-LOC_Os06g32300 intergenic_region ; MODIFIER silent_mutation Average:33.027; most accessible tissue: Zhenshan97 young leaf, score: 50.669 N N N N
vg0618798718 G -> DEL N N silent_mutation Average:33.027; most accessible tissue: Zhenshan97 young leaf, score: 50.669 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0618798718 NA 4.48E-10 mr1002 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618798718 NA 4.20E-08 mr1002 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618798718 5.14E-09 1.09E-16 mr1182 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618798718 6.85E-06 2.72E-09 mr1182 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618798718 3.64E-07 1.55E-13 mr1282 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618798718 NA 9.71E-08 mr1282 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618798718 NA 3.23E-07 mr1330 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618798718 5.26E-09 3.69E-16 mr1650 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618798718 1.99E-06 1.06E-08 mr1650 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618798718 1.29E-06 4.00E-12 mr1658 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618798718 NA 3.93E-07 mr1658 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618798718 NA 2.03E-07 mr1748 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618798718 NA 1.53E-06 mr1880 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618798718 NA 1.12E-07 mr1137_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618798718 NA 6.92E-13 mr1182_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618798718 NA 1.20E-06 mr1182_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618798718 NA 1.36E-07 mr1229_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618798718 NA 1.90E-10 mr1282_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618798718 NA 8.85E-06 mr1282_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618798718 NA 3.40E-07 mr1880_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251