Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0618478687:

Variant ID: vg0618478687 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 18478687
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.67, A: 0.34, others allele: 0.00, population size: 86. )

Flanking Sequence (100 bp) in Reference Genome:

CTGTACCCACAAGACACAATCCACCGGCATGTCACCGCGCCTGGCCGGACACGTCACCATGTCGAGTGATTGTGACAAGACCCTTCATATAACCACCTCT[A/G]
ACCAATCGCACCAAACCACAGGTTTCGCCCCCGTCCCCAGCAGGCAACGGGCAGCCCCCCTCGTACCACGGTCGATCCGGAAGCCGCAAAGGCCGTCGCA

Reverse complement sequence

TGCGACGGCCTTTGCGGCTTCCGGATCGACCGTGGTACGAGGGGGGCTGCCCGTTGCCTGCTGGGGACGGGGGCGAAACCTGTGGTTTGGTGCGATTGGT[T/C]
AGAGGTGGTTATATGAAGGGTCTTGTCACAATCACTCGACATGGTGACGTGTCCGGCCAGGCGCGGTGACATGCCGGTGGATTGTGTCTTGTGGGTACAG

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	36.40%	5.80%	0.32%	57.49%	NA
All Indica	2759	13.20%	2.90%	0.36%	83.58%	NA
All Japonica	1512	86.00%	6.10%	0.13%	7.80%	NA
Aus	269	6.70%	0.40%	0.37%	92.57%	NA
Indica I	595	26.10%	3.40%	0.50%	70.08%	NA
Indica II	465	14.00%	1.10%	0.43%	84.52%	NA
Indica III	913	3.30%	1.50%	0.11%	95.07%	NA
Indica Intermediate	786	14.50%	5.10%	0.51%	79.90%	NA
Temperate Japonica	767	87.10%	7.00%	0.13%	5.74%	NA
Tropical Japonica	504	84.70%	3.40%	0.00%	11.90%	NA
Japonica Intermediate	241	85.10%	8.70%	0.41%	5.81%	NA
VI/Aromatic	96	3.10%	89.60%	0.00%	7.29%	NA
Intermediate	90	41.10%	15.60%	2.22%	41.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0618478687	A -> G	LOC_Os06g31810.1	upstream_gene_variant ; 4468.0bp to feature; MODIFIER	silent_mutation	Average:15.933; most accessible tissue: Minghui63 panicle, score: 29.741	N	N	N	N
vg0618478687	A -> G	LOC_Os06g31820.1	intron_variant ; MODIFIER	silent_mutation	Average:15.933; most accessible tissue: Minghui63 panicle, score: 29.741	N	N	N	N
vg0618478687	A -> DEL	N	N	silent_mutation	Average:15.933; most accessible tissue: Minghui63 panicle, score: 29.741	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0618478687	NA	6.70E-10	mr1354	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618478687	NA	5.78E-09	mr1658	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618478687	NA	1.28E-20	mr1676	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618478687	NA	8.33E-07	mr1677	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618478687	NA	2.91E-06	mr1681	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618478687	NA	2.46E-14	mr1900	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618478687	NA	1.17E-20	mr1042_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618478687	NA	6.02E-06	mr1043_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618478687	NA	2.45E-06	mr1062_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618478687	NA	1.46E-19	mr1167_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618478687	NA	1.02E-06	mr1167_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618478687	2.75E-06	NA	mr1182_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618478687	NA	1.50E-06	mr1269_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618478687	NA	1.07E-06	mr1269_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618478687	5.72E-07	3.62E-12	mr1282_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618478687	NA	1.71E-10	mr1354_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618478687	NA	3.38E-08	mr1399_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618478687	NA	4.55E-06	mr1456_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618478687	NA	2.12E-08	mr1479_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618478687	NA	1.68E-06	mr1479_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618478687	NA	4.23E-07	mr1662_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618478687	NA	1.27E-11	mr1667_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618478687	NA	6.03E-06	mr1677_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618478687	NA	5.05E-11	mr1680_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618478687	NA	5.46E-10	mr1681_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618478687	NA	1.93E-15	mr1726_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618478687	NA	6.97E-06	mr1726_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251