\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0618478687:

Variant ID: vg0618478687 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 18478687
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.67, A: 0.34, others allele: 0.00, population size: 86. )

Flanking Sequence (100 bp) in Reference Genome:


CTGTACCCACAAGACACAATCCACCGGCATGTCACCGCGCCTGGCCGGACACGTCACCATGTCGAGTGATTGTGACAAGACCCTTCATATAACCACCTCT[A/G]
ACCAATCGCACCAAACCACAGGTTTCGCCCCCGTCCCCAGCAGGCAACGGGCAGCCCCCCTCGTACCACGGTCGATCCGGAAGCCGCAAAGGCCGTCGCA

Reverse complement sequence

TGCGACGGCCTTTGCGGCTTCCGGATCGACCGTGGTACGAGGGGGGCTGCCCGTTGCCTGCTGGGGACGGGGGCGAAACCTGTGGTTTGGTGCGATTGGT[T/C]
AGAGGTGGTTATATGAAGGGTCTTGTCACAATCACTCGACATGGTGACGTGTCCGGCCAGGCGCGGTGACATGCCGGTGGATTGTGTCTTGTGGGTACAG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 36.40% 5.80% 0.32% 57.49% NA
All Indica  2759 13.20% 2.90% 0.36% 83.58% NA
All Japonica  1512 86.00% 6.10% 0.13% 7.80% NA
Aus  269 6.70% 0.40% 0.37% 92.57% NA
Indica I  595 26.10% 3.40% 0.50% 70.08% NA
Indica II  465 14.00% 1.10% 0.43% 84.52% NA
Indica III  913 3.30% 1.50% 0.11% 95.07% NA
Indica Intermediate  786 14.50% 5.10% 0.51% 79.90% NA
Temperate Japonica  767 87.10% 7.00% 0.13% 5.74% NA
Tropical Japonica  504 84.70% 3.40% 0.00% 11.90% NA
Japonica Intermediate  241 85.10% 8.70% 0.41% 5.81% NA
VI/Aromatic  96 3.10% 89.60% 0.00% 7.29% NA
Intermediate  90 41.10% 15.60% 2.22% 41.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0618478687 A -> G LOC_Os06g31810.1 upstream_gene_variant ; 4468.0bp to feature; MODIFIER silent_mutation Average:15.933; most accessible tissue: Minghui63 panicle, score: 29.741 N N N N
vg0618478687 A -> G LOC_Os06g31820.1 intron_variant ; MODIFIER silent_mutation Average:15.933; most accessible tissue: Minghui63 panicle, score: 29.741 N N N N
vg0618478687 A -> DEL N N silent_mutation Average:15.933; most accessible tissue: Minghui63 panicle, score: 29.741 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0618478687 NA 6.70E-10 mr1354 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618478687 NA 5.78E-09 mr1658 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618478687 NA 1.28E-20 mr1676 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618478687 NA 8.33E-07 mr1677 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618478687 NA 2.91E-06 mr1681 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618478687 NA 2.46E-14 mr1900 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618478687 NA 1.17E-20 mr1042_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618478687 NA 6.02E-06 mr1043_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618478687 NA 2.45E-06 mr1062_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618478687 NA 1.46E-19 mr1167_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618478687 NA 1.02E-06 mr1167_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618478687 2.75E-06 NA mr1182_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618478687 NA 1.50E-06 mr1269_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618478687 NA 1.07E-06 mr1269_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618478687 5.72E-07 3.62E-12 mr1282_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618478687 NA 1.71E-10 mr1354_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618478687 NA 3.38E-08 mr1399_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618478687 NA 4.55E-06 mr1456_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618478687 NA 2.12E-08 mr1479_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618478687 NA 1.68E-06 mr1479_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618478687 NA 4.23E-07 mr1662_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618478687 NA 1.27E-11 mr1667_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618478687 NA 6.03E-06 mr1677_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618478687 NA 5.05E-11 mr1680_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618478687 NA 5.46E-10 mr1681_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618478687 NA 1.93E-15 mr1726_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618478687 NA 6.97E-06 mr1726_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251