\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0616470948:

Variant ID: vg0616470948 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 16470948
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 128. )

Flanking Sequence (100 bp) in Reference Genome:


GTTAGATTGATCTCGATTAAACTCTATATTTGGTGATCGATTGCTATTTGATATACTTATATAGATTGACTTGTTTATATAATCTTGTATTGGAGTAATA[G/A]
CCAATACGTTATCTATCTTTGCTCTAAATACTGATCTATCAGCTATTTCTATAATATTGTCTTAAAGTAACTAATAAAAACAAAATAGACAATATTACAG

Reverse complement sequence

CTGTAATATTGTCTATTTTGTTTTTATTAGTTACTTTAAGACAATATTATAGAAATAGCTGATAGATCAGTATTTAGAGCAAAGATAGATAACGTATTGG[C/T]
TATTACTCCAATACAAGATTATATAAACAAGTCAATCTATATAAGTATATCAAATAGCAATCGATCACCAAATATAGAGTTTAATCGAGATCAATCTAAC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 97.70% 1.70% 0.70% 0.00% NA
All Indica  2759 96.00% 2.80% 1.20% 0.00% NA
All Japonica  1512 100.00% 0.00% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 88.70% 7.70% 3.53% 0.00% NA
Indica II  465 96.80% 1.50% 1.72% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 96.30% 3.20% 0.51% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 100.00% 0.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0616470948 G -> A LOC_Os06g28880.1 downstream_gene_variant ; 665.0bp to feature; MODIFIER silent_mutation Average:46.302; most accessible tissue: Callus, score: 70.406 N N N N
vg0616470948 G -> A LOC_Os06g28880.2 downstream_gene_variant ; 665.0bp to feature; MODIFIER silent_mutation Average:46.302; most accessible tissue: Callus, score: 70.406 N N N N
vg0616470948 G -> A LOC_Os06g28880.3 downstream_gene_variant ; 665.0bp to feature; MODIFIER silent_mutation Average:46.302; most accessible tissue: Callus, score: 70.406 N N N N
vg0616470948 G -> A LOC_Os06g28870-LOC_Os06g28880 intergenic_region ; MODIFIER silent_mutation Average:46.302; most accessible tissue: Callus, score: 70.406 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0616470948 4.43E-06 NA Plant_height All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0616470948 4.31E-06 NA Plant_height Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0616470948 NA 2.74E-07 mr1002 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616470948 NA 4.24E-10 mr1038 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616470948 NA 3.19E-09 mr1038 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616470948 5.49E-07 2.38E-13 mr1389 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616470948 8.96E-06 8.03E-11 mr1389 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616470948 NA 8.11E-08 mr1002_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616470948 NA 9.75E-06 mr1027_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616470948 1.84E-10 2.49E-17 mr1038_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616470948 1.16E-09 7.07E-15 mr1038_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616470948 2.24E-07 NA mr1141_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616470948 2.90E-07 NA mr1141_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616470948 3.24E-10 1.88E-16 mr1389_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616470948 2.35E-09 1.57E-14 mr1389_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616470948 NA 5.31E-06 mr1521_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616470948 NA 6.86E-06 mr1743_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616470948 NA 9.67E-06 mr1743_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616470948 NA 9.68E-06 mr1864_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616470948 NA 1.74E-08 mr1968_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251