| Variant ID: vg0611510915 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 11510915 |
| Reference Allele: A | Alternative Allele: C |
| Primary Allele: A | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.75, A: 0.25, others allele: 0.00, population size: 76. )
TGGCCCATTCCCCGGCCCAACTATCCCAATCCTAGTGTCCCACAAGGCTATAATAACCCTAAAACATAGAGCTGCTCCAGTTTGATAGCTCCCTACCCAG[A/C]
TACCCTGATACTTTATAGAATTATTACAGTTATATGTCATCAAATTTATAAGGGACAATTTTGTTTTTACCCCTACTTTCATCTCCAATATTGATTTTGC
GCAAAATCAATATTGGAGATGAAAGTAGGGGTAAAAACAAAATTGTCCCTTATAAATTTGATGACATATAACTGTAATAATTCTATAAAGTATCAGGGTA[T/G]
CTGGGTAGGGAGCTATCAAACTGGAGCAGCTCTATGTTTTAGGGTTATTATAGCCTTGTGGGACACTAGGATTGGGATAGTTGGGCCGGGGAATGGGCCA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 36.30% | 34.50% | 16.21% | 13.01% | NA |
| All Indica | 2759 | 3.80% | 56.80% | 23.81% | 15.55% | NA |
| All Japonica | 1512 | 89.60% | 1.50% | 3.17% | 5.75% | NA |
| Aus | 269 | 72.90% | 3.00% | 15.24% | 8.92% | NA |
| Indica I | 595 | 6.60% | 68.40% | 11.09% | 13.95% | NA |
| Indica II | 465 | 2.40% | 77.60% | 10.54% | 9.46% | NA |
| Indica III | 913 | 1.20% | 41.00% | 41.07% | 16.76% | NA |
| Indica Intermediate | 786 | 5.60% | 54.20% | 21.25% | 18.96% | NA |
| Temperate Japonica | 767 | 96.50% | 1.00% | 1.43% | 1.04% | NA |
| Tropical Japonica | 504 | 76.00% | 2.40% | 6.75% | 14.88% | NA |
| Japonica Intermediate | 241 | 95.90% | 1.20% | 1.24% | 1.66% | NA |
| VI/Aromatic | 96 | 25.00% | 9.40% | 7.29% | 58.33% | NA |
| Intermediate | 90 | 38.90% | 25.60% | 14.44% | 21.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0611510915 | A -> C | LOC_Os06g20060.1 | upstream_gene_variant ; 3546.0bp to feature; MODIFIER | silent_mutation | Average:66.065; most accessible tissue: Zhenshan97 young leaf, score: 80.056 | N | N | N | N |
| vg0611510915 | A -> C | LOC_Os06g20080.1 | upstream_gene_variant ; 1636.0bp to feature; MODIFIER | silent_mutation | Average:66.065; most accessible tissue: Zhenshan97 young leaf, score: 80.056 | N | N | N | N |
| vg0611510915 | A -> C | LOC_Os06g20090.1 | upstream_gene_variant ; 4493.0bp to feature; MODIFIER | silent_mutation | Average:66.065; most accessible tissue: Zhenshan97 young leaf, score: 80.056 | N | N | N | N |
| vg0611510915 | A -> C | LOC_Os06g20070.1 | downstream_gene_variant ; 139.0bp to feature; MODIFIER | silent_mutation | Average:66.065; most accessible tissue: Zhenshan97 young leaf, score: 80.056 | N | N | N | N |
| vg0611510915 | A -> C | LOC_Os06g20070-LOC_Os06g20080 | intergenic_region ; MODIFIER | silent_mutation | Average:66.065; most accessible tissue: Zhenshan97 young leaf, score: 80.056 | N | N | N | N |
| vg0611510915 | A -> DEL | N | N | silent_mutation | Average:66.065; most accessible tissue: Zhenshan97 young leaf, score: 80.056 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0611510915 | 5.14E-06 | 7.14E-58 | mr1065 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611510915 | NA | 4.58E-43 | mr1067 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611510915 | 2.37E-07 | 2.54E-58 | mr1068 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611510915 | 3.66E-07 | 9.08E-09 | mr1068 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611510915 | 6.48E-07 | 4.31E-65 | mr1087 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611510915 | 1.16E-06 | 1.55E-10 | mr1087 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611510915 | NA | 5.76E-55 | mr1090 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611510915 | NA | 1.10E-37 | mr1091 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611510915 | NA | 4.86E-36 | mr1094 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611510915 | NA | 7.16E-46 | mr1108 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/