| Variant ID: vg0610763769 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 10763769 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.70, G: 0.29, others allele: 0.00, population size: 232. )
GGGTGGTGATGCGCCAAGATTGTATTGAATGTGTGTGTATTTTACATAGGACTCGGGGTCTATTTATACCCGAGGATTACAAGATACGCCCATACCGGAC[A/G]
CGACTATTATCTCTAACAAACTCTAAGATACCATAAGTCTTTACGGCAAACTTTTGCCCACATCTATCTCTAAGGAATTTACATAAAATATCCTAATTAA
TTAATTAGGATATTTTATGTAAATTCCTTAGAGATAGATGTGGGCAAAAGTTTGCCGTAAAGACTTATGGTATCTTAGAGTTTGTTAGAGATAATAGTCG[T/C]
GTCCGGTATGGGCGTATCTTGTAATCCTCGGGTATAAATAGACCCCGAGTCCTATGTAAAATACACACACATTCAATACAATCTTGGCGCATCACCACCC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 83.30% | 16.70% | 0.02% | 0.00% | NA |
| All Indica | 2759 | 73.10% | 26.90% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 98.20% | 1.80% | 0.00% | 0.00% | NA |
| Aus | 269 | 97.40% | 2.60% | 0.00% | 0.00% | NA |
| Indica I | 595 | 96.80% | 3.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 90.30% | 9.70% | 0.00% | 0.00% | NA |
| Indica III | 913 | 50.40% | 49.60% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 71.20% | 28.60% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 96.70% | 3.30% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 92.70% | 7.30% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 93.30% | 6.70% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0610763769 | A -> G | LOC_Os06g18940.1 | upstream_gene_variant ; 626.0bp to feature; MODIFIER | silent_mutation | Average:25.568; most accessible tissue: Minghui63 panicle, score: 34.226 | N | N | N | N |
| vg0610763769 | A -> G | LOC_Os06g18930.1 | downstream_gene_variant ; 3774.0bp to feature; MODIFIER | silent_mutation | Average:25.568; most accessible tissue: Minghui63 panicle, score: 34.226 | N | N | N | N |
| vg0610763769 | A -> G | LOC_Os06g18950.1 | downstream_gene_variant ; 4178.0bp to feature; MODIFIER | silent_mutation | Average:25.568; most accessible tissue: Minghui63 panicle, score: 34.226 | N | N | N | N |
| vg0610763769 | A -> G | LOC_Os06g18930-LOC_Os06g18940 | intergenic_region ; MODIFIER | silent_mutation | Average:25.568; most accessible tissue: Minghui63 panicle, score: 34.226 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0610763769 | 3.13E-12 | NA | mr1065 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610763769 | 5.91E-15 | 1.22E-23 | mr1065 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610763769 | 4.11E-07 | NA | mr1067 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610763769 | 3.08E-09 | 7.06E-15 | mr1067 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610763769 | 4.37E-16 | NA | mr1068 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610763769 | 1.23E-21 | 3.15E-34 | mr1068 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610763769 | 3.26E-08 | NA | mr1078 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610763769 | 5.36E-13 | 4.41E-21 | mr1078 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610763769 | 4.89E-17 | NA | mr1087 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610763769 | 1.38E-24 | 2.53E-31 | mr1087 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/