| Variant ID: vg0610608095 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 10608095 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.97, C: 0.03, others allele: 0.00, population size: 100. )
TAGATGTGCCAACTCATGTTATATGCAACAGATTGAATGGTTACATAAGTTGATAATTTCGGATTATGCGGCAAATAGCCTATCGGATAGTCCGCATCTG[T/C]
TGTATTTTAGAGATATCTTGTCCGCATCTGCATCCATATCCATCGGATTTCTAAAAACTCATACCATATCATCGTTTCAGATGGATTCGAAGCGGATAGG
CCTATCCGCTTCGAATCCATCTGAAACGATGATATGGTATGAGTTTTTAGAAATCCGATGGATATGGATGCAGATGCGGACAAGATATCTCTAAAATACA[A/G]
CAGATGCGGACTATCCGATAGGCTATTTGCCGCATAATCCGAAATTATCAACTTATGTAACCATTCAATCTGTTGCATATAACATGAGTTGGCACATCTA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 53.80% | 40.60% | 4.57% | 0.97% | NA |
| All Indica | 2759 | 32.10% | 61.30% | 5.29% | 1.34% | NA |
| All Japonica | 1512 | 86.90% | 9.10% | 3.70% | 0.33% | NA |
| Aus | 269 | 81.80% | 16.00% | 2.23% | 0.00% | NA |
| Indica I | 595 | 12.30% | 86.70% | 1.01% | 0.00% | NA |
| Indica II | 465 | 4.70% | 90.10% | 4.95% | 0.22% | NA |
| Indica III | 913 | 49.30% | 37.90% | 8.87% | 3.94% | NA |
| Indica Intermediate | 786 | 43.30% | 52.20% | 4.58% | 0.00% | NA |
| Temperate Japonica | 767 | 90.50% | 3.00% | 6.13% | 0.39% | NA |
| Tropical Japonica | 504 | 78.60% | 20.80% | 0.60% | 0.00% | NA |
| Japonica Intermediate | 241 | 92.90% | 3.70% | 2.49% | 0.83% | NA |
| VI/Aromatic | 96 | 86.50% | 5.20% | 5.21% | 3.12% | NA |
| Intermediate | 90 | 46.70% | 48.90% | 3.33% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0610608095 | T -> C | LOC_Os06g18710.1 | upstream_gene_variant ; 1117.0bp to feature; MODIFIER | silent_mutation | Average:56.204; most accessible tissue: Zhenshan97 young leaf, score: 79.507 | N | N | N | N |
| vg0610608095 | T -> C | LOC_Os06g18690-LOC_Os06g18710 | intergenic_region ; MODIFIER | silent_mutation | Average:56.204; most accessible tissue: Zhenshan97 young leaf, score: 79.507 | N | N | N | N |
| vg0610608095 | T -> DEL | N | N | silent_mutation | Average:56.204; most accessible tissue: Zhenshan97 young leaf, score: 79.507 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0610608095 | 4.26E-31 | 5.18E-107 | mr1065 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610608095 | 2.72E-27 | 8.59E-48 | mr1065 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610608095 | 4.66E-13 | 3.30E-68 | mr1067 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610608095 | 3.49E-14 | 3.20E-27 | mr1067 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610608095 | 8.35E-53 | 2.49E-138 | mr1068 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610608095 | 3.47E-38 | 6.77E-65 | mr1068 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610608095 | 3.91E-12 | 3.91E-12 | mr1068 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610608095 | 5.37E-34 | 6.83E-100 | mr1078 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610608095 | 5.03E-25 | 6.30E-42 | mr1078 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610608095 | 5.48E-07 | 5.89E-08 | mr1078 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/