| Variant ID: vg0610556004 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 10556004 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.94, C: 0.06, others allele: 0.00, population size: 49. )
AGAAATCCCACCAACCGTCGGCGGCTTTGCAACTATACTCCTATACACCCCGCTCGCTGCTTATCCTTTTTATTGTCATTGAGATTTTAAAAATTAAATA[T/C]
GATTATCAATGGGGTTTATTTTTTTACTTTATAGAAGTCTTGGCAACCGCCTTGCCCGTTTGCTTCACGGCCTACCTGTCGTCCATCTTTTTAATCGTCA
TGACGATTAAAAAGATGGACGACAGGTAGGCCGTGAAGCAAACGGGCAAGGCGGTTGCCAAGACTTCTATAAAGTAAAAAAATAAACCCCATTGATAATC[A/G]
TATTTAATTTTTAAAATCTCAATGACAATAAAAAGGATAAGCAGCGAGCGGGGTGTATAGGAGTATAGTTGCAAAGCCGCCGACGGTTGGTGGGATTTCT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 54.60% | 44.80% | 0.49% | 0.11% | NA |
| All Indica | 2759 | 72.80% | 26.90% | 0.29% | 0.00% | NA |
| All Japonica | 1512 | 34.30% | 65.00% | 0.60% | 0.13% | NA |
| Aus | 269 | 0.70% | 96.70% | 1.49% | 1.12% | NA |
| Indica I | 595 | 80.50% | 19.00% | 0.50% | 0.00% | NA |
| Indica II | 465 | 88.60% | 11.40% | 0.00% | 0.00% | NA |
| Indica III | 913 | 60.50% | 39.50% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 72.00% | 27.40% | 0.64% | 0.00% | NA |
| Temperate Japonica | 767 | 53.80% | 45.10% | 0.91% | 0.13% | NA |
| Tropical Japonica | 504 | 10.50% | 89.10% | 0.40% | 0.00% | NA |
| Japonica Intermediate | 241 | 21.60% | 78.00% | 0.00% | 0.41% | NA |
| VI/Aromatic | 96 | 2.10% | 96.90% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 53.30% | 45.60% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0610556004 | T -> C | LOC_Os06g18130.1 | upstream_gene_variant ; 3562.0bp to feature; MODIFIER | silent_mutation | Average:47.593; most accessible tissue: Zhenshan97 panicle, score: 67.02 | N | N | N | N |
| vg0610556004 | T -> C | LOC_Os06g18140.1 | downstream_gene_variant ; 813.0bp to feature; MODIFIER | silent_mutation | Average:47.593; most accessible tissue: Zhenshan97 panicle, score: 67.02 | N | N | N | N |
| vg0610556004 | T -> C | LOC_Os06g18150.2 | downstream_gene_variant ; 3760.0bp to feature; MODIFIER | silent_mutation | Average:47.593; most accessible tissue: Zhenshan97 panicle, score: 67.02 | N | N | N | N |
| vg0610556004 | T -> C | LOC_Os06g18140-LOC_Os06g18150 | intergenic_region ; MODIFIER | silent_mutation | Average:47.593; most accessible tissue: Zhenshan97 panicle, score: 67.02 | N | N | N | N |
| vg0610556004 | T -> DEL | N | N | silent_mutation | Average:47.593; most accessible tissue: Zhenshan97 panicle, score: 67.02 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0610556004 | 5.37E-06 | NA | mr1065 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610556004 | 8.82E-15 | 6.23E-21 | mr1065 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610556004 | 2.83E-07 | 7.54E-12 | mr1067 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610556004 | 1.36E-08 | 6.80E-10 | mr1068 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610556004 | 4.54E-08 | 3.05E-08 | mr1078 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610556004 | 1.12E-17 | 1.00E-19 | mr1087 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610556004 | NA | 7.09E-07 | mr1087 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610556004 | 3.56E-06 | NA | mr1090 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610556004 | 5.08E-06 | NA | mr1091 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610556004 | 4.02E-15 | 5.83E-24 | mr1091 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/