\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0610495466:

Variant ID: vg0610495466 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 10495466
Reference Allele: CAlternative Allele: G
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATAATGTTATTTTGTCTAGTTTGGTTACCTTTTAATTTTGGTTGGTGTGTTTGCTTTCTTTTGGTCTGCACTCTTACAGAGTGCTAGTTTGTAATAATTG[C/G]
CTGTAGCTCTTTTGAGCAAAGGCCGGGATGTTATTTTATTCCATTATCTAAAAAAAGAAAAATGTTCTAGCATCCTAGTTTTTTCTTTTCTCTTTTCTCT

Reverse complement sequence

AGAGAAAAGAGAAAAGAAAAAACTAGGATGCTAGAACATTTTTCTTTTTTTAGATAATGGAATAAAATAACATCCCGGCCTTTGCTCAAAAGAGCTACAG[G/C]
CAATTATTACAAACTAGCACTCTGTAAGAGTGCAGACCAAAAGAAAGCAAACACACCAACCAAAATTAAAAGGTAACCAAACTAGACAAAATAACATTAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.10% 11.70% 6.20% 23.91% NA
All Indica  2759 73.40% 6.90% 6.85% 12.90% NA
All Japonica  1512 39.90% 15.10% 3.77% 41.20% NA
Aus  269 19.30% 39.00% 14.87% 26.77% NA
Indica I  595 93.60% 0.50% 1.18% 4.71% NA
Indica II  465 90.80% 1.50% 4.30% 3.44% NA
Indica III  913 56.10% 11.40% 12.71% 19.82% NA
Indica Intermediate  786 67.80% 9.70% 5.85% 16.67% NA
Temperate Japonica  767 55.00% 3.90% 1.83% 39.24% NA
Tropical Japonica  504 24.60% 32.90% 6.15% 36.31% NA
Japonica Intermediate  241 24.10% 13.30% 4.98% 57.68% NA
VI/Aromatic  96 10.40% 19.80% 3.12% 66.67% NA
Intermediate  90 64.40% 14.40% 4.44% 16.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0610495466 C -> G LOC_Os06g18030.1 upstream_gene_variant ; 2737.0bp to feature; MODIFIER silent_mutation Average:31.97; most accessible tissue: Zhenshan97 flag leaf, score: 49.845 N N N N
vg0610495466 C -> G LOC_Os06g18020-LOC_Os06g18030 intergenic_region ; MODIFIER silent_mutation Average:31.97; most accessible tissue: Zhenshan97 flag leaf, score: 49.845 N N N N
vg0610495466 C -> DEL N N silent_mutation Average:31.97; most accessible tissue: Zhenshan97 flag leaf, score: 49.845 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0610495466 2.39E-06 NA mr1068 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610495466 5.02E-06 3.29E-10 mr1068 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610495466 5.07E-06 NA mr1078 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610495466 NA 3.34E-08 mr1078 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610495466 2.47E-07 NA mr1090 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610495466 NA 1.96E-08 mr1090 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610495466 NA 2.60E-07 mr1096 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610495466 NA 6.90E-07 mr1111 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610495466 NA 6.35E-07 mr1121 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610495466 NA 9.79E-09 mr1144 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610495466 NA 5.41E-06 mr1200 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610495466 2.38E-07 NA mr1211 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610495466 1.05E-06 2.45E-08 mr1211 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610495466 2.77E-07 NA mr1068_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610495466 NA 2.41E-11 mr1068_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610495466 NA 2.71E-09 mr1078_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610495466 NA 6.19E-10 mr1087_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610495466 1.45E-06 NA mr1090_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610495466 NA 7.67E-09 mr1090_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610495466 NA 3.75E-07 mr1094_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610495466 7.02E-06 NA mr1096_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610495466 NA 1.03E-08 mr1096_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610495466 8.43E-07 NA mr1111_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610495466 5.73E-07 5.86E-12 mr1111_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610495466 NA 2.33E-08 mr1112_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610495466 NA 8.19E-09 mr1121_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610495466 2.04E-06 NA mr1144_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610495466 1.82E-06 3.04E-10 mr1144_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610495466 2.47E-08 NA mr1211_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610495466 NA 4.61E-09 mr1211_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610495466 NA 2.28E-09 mr1526_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251