| Variant ID: vg0609841754 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 9841754 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 263. )
AAATTGACCCTGCCATATACATTTTTTTAAGAACTTCTCAAATTTACCAAAACAAGGAAGCACACAAACTCAATTTGAAAAAAATAATATGCAAGTCTAA[A/T]
GATTTTTTTTTTTTAAAAGCAAGTCAGTAATTGCAATTGTTTTCAATTAGAATTTATGAAAACAAAACAATAGAACGAGCATAAAAGAATGAACAATGCA
TGCATTGTTCATTCTTTTATGCTCGTTCTATTGTTTTGTTTTCATAAATTCTAATTGAAAACAATTGCAATTACTGACTTGCTTTTAAAAAAAAAAAATC[T/A]
TTAGACTTGCATATTATTTTTTTCAAATTGAGTTTGTGTGCTTCCTTGTTTTGGTAAATTTGAGAAGTTCTTAAAAAAATGTATATGGCAGGGTCAATTT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 87.60% | 1.10% | 8.10% | 3.22% | NA |
| All Indica | 2759 | 88.10% | 0.00% | 8.19% | 3.66% | NA |
| All Japonica | 1512 | 84.90% | 3.40% | 8.99% | 2.71% | NA |
| Aus | 269 | 93.30% | 0.00% | 4.46% | 2.23% | NA |
| Indica I | 595 | 90.10% | 0.00% | 8.74% | 1.18% | NA |
| Indica II | 465 | 83.90% | 0.00% | 11.61% | 4.52% | NA |
| Indica III | 913 | 90.90% | 0.00% | 4.16% | 4.93% | NA |
| Indica Intermediate | 786 | 86.00% | 0.00% | 10.43% | 3.56% | NA |
| Temperate Japonica | 767 | 84.50% | 6.60% | 8.34% | 0.52% | NA |
| Tropical Japonica | 504 | 86.30% | 0.00% | 8.53% | 5.16% | NA |
| Japonica Intermediate | 241 | 83.40% | 0.00% | 12.03% | 4.56% | NA |
| VI/Aromatic | 96 | 95.80% | 0.00% | 0.00% | 4.17% | NA |
| Intermediate | 90 | 90.00% | 0.00% | 10.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0609841754 | A -> T | LOC_Os06g16970.1 | upstream_gene_variant ; 3703.0bp to feature; MODIFIER | silent_mutation | Average:41.356; most accessible tissue: Callus, score: 85.785 | N | N | N | N |
| vg0609841754 | A -> T | LOC_Os06g16980.1 | intron_variant ; MODIFIER | silent_mutation | Average:41.356; most accessible tissue: Callus, score: 85.785 | N | N | N | N |
| vg0609841754 | A -> T | LOC_Os06g16980.2 | intron_variant ; MODIFIER | silent_mutation | Average:41.356; most accessible tissue: Callus, score: 85.785 | N | N | N | N |
| vg0609841754 | A -> DEL | N | N | silent_mutation | Average:41.356; most accessible tissue: Callus, score: 85.785 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0609841754 | 3.68E-08 | 1.03E-10 | mr1210 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609841754 | 1.65E-08 | 9.03E-11 | mr1305 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609841754 | NA | 1.98E-06 | mr1515 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609841754 | 1.55E-08 | 4.77E-13 | mr1585 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609841754 | 4.10E-07 | 8.17E-10 | mr1586 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609841754 | 6.15E-07 | 6.15E-07 | mr1649 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609841754 | NA | 2.29E-07 | mr1765 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609841754 | 1.19E-10 | 8.88E-13 | mr1305_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609841754 | 8.34E-07 | 1.35E-08 | mr1409_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609841754 | 5.02E-07 | 5.55E-08 | mr1559_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/