\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0609807424:

Variant ID: vg0609807424 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 9807424
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.90, C: 0.10, others allele: 0.00, population size: 111. )

Flanking Sequence (100 bp) in Reference Genome:


TAAATTATTAGTATAGCTCTCTCTATTATAATCATCCCACGGGATTAAATAAATACGATACCCTTGGAATACTCTCGGGTGAAATACTATAATGGTATAT[T/C]
CGTGCGCTTACAGATGAAATCGGTAACCATAATATACCACGAGAGTTTCTGCGCCATTGCTGGGAATTATATTTCTAGTAATATCGTTAAGAAACACCAA

Reverse complement sequence

TTGGTGTTTCTTAACGATATTACTAGAAATATAATTCCCAGCAATGGCGCAGAAACTCTCGTGGTATATTATGGTTACCGATTTCATCTGTAAGCGCACG[A/G]
ATATACCATTATAGTATTTCACCCGAGAGTATTCCAAGGGTATCGTATTTATTTAATCCCGTGGGATGATTATAATAGAGAGAGCTATACTAATAATTTA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 50.70% 48.80% 0.21% 0.36% NA
All Indica  2759 75.50% 23.60% 0.33% 0.51% NA
All Japonica  1512 17.40% 82.40% 0.07% 0.13% NA
Aus  269 0.40% 99.60% 0.00% 0.00% NA
Indica I  595 93.80% 4.90% 0.50% 0.84% NA
Indica II  465 73.80% 25.40% 0.22% 0.65% NA
Indica III  913 66.90% 32.50% 0.33% 0.22% NA
Indica Intermediate  786 72.80% 26.50% 0.25% 0.51% NA
Temperate Japonica  767 6.40% 93.50% 0.00% 0.13% NA
Tropical Japonica  504 35.50% 64.50% 0.00% 0.00% NA
Japonica Intermediate  241 14.50% 84.60% 0.41% 0.41% NA
VI/Aromatic  96 2.10% 97.90% 0.00% 0.00% NA
Intermediate  90 48.90% 50.00% 0.00% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0609807424 T -> C LOC_Os06g16919.2 intron_variant ; MODIFIER silent_mutation Average:37.538; most accessible tissue: Zhenshan97 flag leaf, score: 54.545 N N N N
vg0609807424 T -> C LOC_Os06g16919.3 intron_variant ; MODIFIER silent_mutation Average:37.538; most accessible tissue: Zhenshan97 flag leaf, score: 54.545 N N N N
vg0609807424 T -> C LOC_Os06g16919.4 intron_variant ; MODIFIER silent_mutation Average:37.538; most accessible tissue: Zhenshan97 flag leaf, score: 54.545 N N N N
vg0609807424 T -> C LOC_Os06g16919.1 intron_variant ; MODIFIER silent_mutation Average:37.538; most accessible tissue: Zhenshan97 flag leaf, score: 54.545 N N N N
vg0609807424 T -> DEL N N silent_mutation Average:37.538; most accessible tissue: Zhenshan97 flag leaf, score: 54.545 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0609807424 NA 4.60E-06 mr1047 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609807424 2.67E-06 NA mr1087 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609807424 NA 6.92E-06 mr1094 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609807424 NA 8.01E-06 mr1111 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609807424 NA 4.58E-20 mr1598 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609807424 NA 1.99E-12 mr1609 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609807424 NA 2.13E-15 mr1655 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609807424 2.03E-07 NA mr1695 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609807424 4.26E-08 NA mr1695 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609807424 NA 1.78E-10 mr1712 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609807424 NA 4.54E-10 mr1717 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609807424 NA 1.25E-06 mr1748 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609807424 NA 1.63E-10 mr1770 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609807424 NA 4.49E-08 mr1946 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609807424 NA 5.67E-36 mr1221_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609807424 NA 3.76E-22 mr1531_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609807424 4.67E-06 NA mr1695_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251