Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0609807424:

Variant ID: vg0609807424 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 9807424
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.90, C: 0.10, others allele: 0.00, population size: 111. )

Flanking Sequence (100 bp) in Reference Genome:

TAAATTATTAGTATAGCTCTCTCTATTATAATCATCCCACGGGATTAAATAAATACGATACCCTTGGAATACTCTCGGGTGAAATACTATAATGGTATAT[T/C]
CGTGCGCTTACAGATGAAATCGGTAACCATAATATACCACGAGAGTTTCTGCGCCATTGCTGGGAATTATATTTCTAGTAATATCGTTAAGAAACACCAA

Reverse complement sequence

TTGGTGTTTCTTAACGATATTACTAGAAATATAATTCCCAGCAATGGCGCAGAAACTCTCGTGGTATATTATGGTTACCGATTTCATCTGTAAGCGCACG[A/G]
ATATACCATTATAGTATTTCACCCGAGAGTATTCCAAGGGTATCGTATTTATTTAATCCCGTGGGATGATTATAATAGAGAGAGCTATACTAATAATTTA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	50.70%	48.80%	0.21%	0.36%	NA
All Indica	2759	75.50%	23.60%	0.33%	0.51%	NA
All Japonica	1512	17.40%	82.40%	0.07%	0.13%	NA
Aus	269	0.40%	99.60%	0.00%	0.00%	NA
Indica I	595	93.80%	4.90%	0.50%	0.84%	NA
Indica II	465	73.80%	25.40%	0.22%	0.65%	NA
Indica III	913	66.90%	32.50%	0.33%	0.22%	NA
Indica Intermediate	786	72.80%	26.50%	0.25%	0.51%	NA
Temperate Japonica	767	6.40%	93.50%	0.00%	0.13%	NA
Tropical Japonica	504	35.50%	64.50%	0.00%	0.00%	NA
Japonica Intermediate	241	14.50%	84.60%	0.41%	0.41%	NA
VI/Aromatic	96	2.10%	97.90%	0.00%	0.00%	NA
Intermediate	90	48.90%	50.00%	0.00%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0609807424	T -> C	LOC_Os06g16919.2	intron_variant ; MODIFIER	silent_mutation	Average:37.538; most accessible tissue: Zhenshan97 flag leaf, score: 54.545	N	N	N	N
vg0609807424	T -> C	LOC_Os06g16919.3	intron_variant ; MODIFIER	silent_mutation	Average:37.538; most accessible tissue: Zhenshan97 flag leaf, score: 54.545	N	N	N	N
vg0609807424	T -> C	LOC_Os06g16919.4	intron_variant ; MODIFIER	silent_mutation	Average:37.538; most accessible tissue: Zhenshan97 flag leaf, score: 54.545	N	N	N	N
vg0609807424	T -> C	LOC_Os06g16919.1	intron_variant ; MODIFIER	silent_mutation	Average:37.538; most accessible tissue: Zhenshan97 flag leaf, score: 54.545	N	N	N	N
vg0609807424	T -> DEL	N	N	silent_mutation	Average:37.538; most accessible tissue: Zhenshan97 flag leaf, score: 54.545	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0609807424	NA	4.60E-06	mr1047	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609807424	2.67E-06	NA	mr1087	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609807424	NA	6.92E-06	mr1094	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609807424	NA	8.01E-06	mr1111	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609807424	NA	4.58E-20	mr1598	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609807424	NA	1.99E-12	mr1609	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609807424	NA	2.13E-15	mr1655	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609807424	2.03E-07	NA	mr1695	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609807424	4.26E-08	NA	mr1695	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609807424	NA	1.78E-10	mr1712	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609807424	NA	4.54E-10	mr1717	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609807424	NA	1.25E-06	mr1748	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609807424	NA	1.63E-10	mr1770	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609807424	NA	4.49E-08	mr1946	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609807424	NA	5.67E-36	mr1221_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609807424	NA	3.76E-22	mr1531_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609807424	4.67E-06	NA	mr1695_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251