\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0607991416:

Variant ID: vg0607991416 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 7991416
Reference Allele: GAlternative Allele: A,T
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTTGATAAATCAGTTTTATTTGTTGTTAATAACTATTATAATTTTTACTTTTAACTCGATTATTTAAAAAATATTAAAAATTACTTAGGAATTTCCACAG[G/A,T]
AAAGCGCGGGGAATAAACTAGTATGGGTTATAGTATTTGCCTTGATTTGTACTCTCATAAACAGTGGTTGTGTAAGATTTGATTTAACGGTGGATAACGT

Reverse complement sequence

ACGTTATCCACCGTTAAATCAAATCTTACACAACCACTGTTTATGAGAGTACAAATCAAGGCAAATACTATAACCCATACTAGTTTATTCCCCGCGCTTT[C/T,A]
CTGTGGAAATTCCTAAGTAATTTTTAATATTTTTTAAATAATCGAGTTAAAAGTAAAAATTATAATAGTTATTAACAACAAATAAAACTGATTTATCAAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 56.60% 41.70% 1.18% 0.55% NA
All Indica  2759 37.60% 59.60% 1.96% 0.91% NA
All Japonica  1512 82.90% 17.10% 0.07% 0.00% NA
Aus  269 98.90% 0.70% 0.00% 0.37% NA
Indica I  595 56.30% 38.30% 4.37% 1.01% NA
Indica II  465 8.60% 90.10% 0.86% 0.43% NA
Indica III  913 41.70% 56.60% 0.66% 0.99% NA
Indica Intermediate  786 35.80% 60.90% 2.29% 1.02% NA
Temperate Japonica  767 72.50% 27.50% 0.00% 0.00% NA
Tropical Japonica  504 98.40% 1.60% 0.00% 0.00% NA
Japonica Intermediate  241 83.40% 16.20% 0.41% 0.00% NA
VI/Aromatic  96 72.90% 27.10% 0.00% 0.00% NA
Intermediate  90 53.30% 45.60% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0607991416 G -> T LOC_Os06g14324.1 upstream_gene_variant ; 458.0bp to feature; MODIFIER N Average:58.275; most accessible tissue: Zhenshan97 root, score: 75.275 N N N N
vg0607991416 G -> T LOC_Os06g14324.2 upstream_gene_variant ; 3467.0bp to feature; MODIFIER N Average:58.275; most accessible tissue: Zhenshan97 root, score: 75.275 N N N N
vg0607991416 G -> T LOC_Os06g14340.1 downstream_gene_variant ; 606.0bp to feature; MODIFIER N Average:58.275; most accessible tissue: Zhenshan97 root, score: 75.275 N N N N
vg0607991416 G -> T LOC_Os06g14324-LOC_Os06g14340 intergenic_region ; MODIFIER N Average:58.275; most accessible tissue: Zhenshan97 root, score: 75.275 N N N N
vg0607991416 G -> A LOC_Os06g14324.1 upstream_gene_variant ; 458.0bp to feature; MODIFIER silent_mutation Average:58.275; most accessible tissue: Zhenshan97 root, score: 75.275 N N N N
vg0607991416 G -> A LOC_Os06g14324.2 upstream_gene_variant ; 3467.0bp to feature; MODIFIER silent_mutation Average:58.275; most accessible tissue: Zhenshan97 root, score: 75.275 N N N N
vg0607991416 G -> A LOC_Os06g14340.1 downstream_gene_variant ; 606.0bp to feature; MODIFIER silent_mutation Average:58.275; most accessible tissue: Zhenshan97 root, score: 75.275 N N N N
vg0607991416 G -> A LOC_Os06g14324-LOC_Os06g14340 intergenic_region ; MODIFIER silent_mutation Average:58.275; most accessible tissue: Zhenshan97 root, score: 75.275 N N N N
vg0607991416 G -> DEL N N silent_mutation Average:58.275; most accessible tissue: Zhenshan97 root, score: 75.275 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0607991416 3.33E-06 NA mr1030_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607991416 1.64E-07 1.67E-10 mr1170_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607991416 NA 2.14E-08 mr1170_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607991416 NA 5.64E-07 mr1184_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607991416 NA 7.22E-07 mr1257_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607991416 NA 6.96E-08 mr1278_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607991416 5.71E-07 5.45E-10 mr1329_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607991416 6.32E-08 2.20E-09 mr1337_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607991416 3.43E-06 NA mr1342_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607991416 NA 8.24E-07 mr1374_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607991416 NA 1.07E-12 mr1377_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607991416 NA 2.96E-06 mr1377_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607991416 1.75E-06 2.14E-09 mr1524_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607991416 NA 4.97E-13 mr1552_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607991416 5.80E-06 NA mr1555_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607991416 1.12E-07 5.29E-11 mr1668_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607991416 NA 2.21E-09 mr1709_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607991416 8.12E-09 3.00E-10 mr1754_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607991416 NA 1.79E-09 mr1819_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607991416 4.17E-06 NA mr1965_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607991416 3.58E-06 NA mr1980_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607991416 1.97E-06 5.39E-08 mr1982_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251