Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0607991416:

Variant ID: vg0607991416 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 7991416
Reference Allele: G	Alternative Allele: A,T
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTTGATAAATCAGTTTTATTTGTTGTTAATAACTATTATAATTTTTACTTTTAACTCGATTATTTAAAAAATATTAAAAATTACTTAGGAATTTCCACAG[G/A,T]
AAAGCGCGGGGAATAAACTAGTATGGGTTATAGTATTTGCCTTGATTTGTACTCTCATAAACAGTGGTTGTGTAAGATTTGATTTAACGGTGGATAACGT

Reverse complement sequence

ACGTTATCCACCGTTAAATCAAATCTTACACAACCACTGTTTATGAGAGTACAAATCAAGGCAAATACTATAACCCATACTAGTTTATTCCCCGCGCTTT[C/T,A]
CTGTGGAAATTCCTAAGTAATTTTTAATATTTTTTAAATAATCGAGTTAAAAGTAAAAATTATAATAGTTATTAACAACAAATAAAACTGATTTATCAAA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	56.60%	41.70%	1.18%	0.55%	NA
All Indica	2759	37.60%	59.60%	1.96%	0.91%	NA
All Japonica	1512	82.90%	17.10%	0.07%	0.00%	NA
Aus	269	98.90%	0.70%	0.00%	0.37%	NA
Indica I	595	56.30%	38.30%	4.37%	1.01%	NA
Indica II	465	8.60%	90.10%	0.86%	0.43%	NA
Indica III	913	41.70%	56.60%	0.66%	0.99%	NA
Indica Intermediate	786	35.80%	60.90%	2.29%	1.02%	NA
Temperate Japonica	767	72.50%	27.50%	0.00%	0.00%	NA
Tropical Japonica	504	98.40%	1.60%	0.00%	0.00%	NA
Japonica Intermediate	241	83.40%	16.20%	0.41%	0.00%	NA
VI/Aromatic	96	72.90%	27.10%	0.00%	0.00%	NA
Intermediate	90	53.30%	45.60%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0607991416	G -> T	LOC_Os06g14324.1	upstream_gene_variant ; 458.0bp to feature; MODIFIER	N	Average:58.275; most accessible tissue: Zhenshan97 root, score: 75.275	N	N	N	N
vg0607991416	G -> T	LOC_Os06g14324.2	upstream_gene_variant ; 3467.0bp to feature; MODIFIER	N	Average:58.275; most accessible tissue: Zhenshan97 root, score: 75.275	N	N	N	N
vg0607991416	G -> T	LOC_Os06g14340.1	downstream_gene_variant ; 606.0bp to feature; MODIFIER	N	Average:58.275; most accessible tissue: Zhenshan97 root, score: 75.275	N	N	N	N
vg0607991416	G -> T	LOC_Os06g14324-LOC_Os06g14340	intergenic_region ; MODIFIER	N	Average:58.275; most accessible tissue: Zhenshan97 root, score: 75.275	N	N	N	N
vg0607991416	G -> A	LOC_Os06g14324.1	upstream_gene_variant ; 458.0bp to feature; MODIFIER	silent_mutation	Average:58.275; most accessible tissue: Zhenshan97 root, score: 75.275	N	N	N	N
vg0607991416	G -> A	LOC_Os06g14324.2	upstream_gene_variant ; 3467.0bp to feature; MODIFIER	silent_mutation	Average:58.275; most accessible tissue: Zhenshan97 root, score: 75.275	N	N	N	N
vg0607991416	G -> A	LOC_Os06g14340.1	downstream_gene_variant ; 606.0bp to feature; MODIFIER	silent_mutation	Average:58.275; most accessible tissue: Zhenshan97 root, score: 75.275	N	N	N	N
vg0607991416	G -> A	LOC_Os06g14324-LOC_Os06g14340	intergenic_region ; MODIFIER	silent_mutation	Average:58.275; most accessible tissue: Zhenshan97 root, score: 75.275	N	N	N	N
vg0607991416	G -> DEL	N	N	silent_mutation	Average:58.275; most accessible tissue: Zhenshan97 root, score: 75.275	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0607991416	3.33E-06	NA	mr1030_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607991416	1.64E-07	1.67E-10	mr1170_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607991416	NA	2.14E-08	mr1170_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607991416	NA	5.64E-07	mr1184_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607991416	NA	7.22E-07	mr1257_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607991416	NA	6.96E-08	mr1278_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607991416	5.71E-07	5.45E-10	mr1329_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607991416	6.32E-08	2.20E-09	mr1337_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607991416	3.43E-06	NA	mr1342_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607991416	NA	8.24E-07	mr1374_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607991416	NA	1.07E-12	mr1377_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607991416	NA	2.96E-06	mr1377_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607991416	1.75E-06	2.14E-09	mr1524_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607991416	NA	4.97E-13	mr1552_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607991416	5.80E-06	NA	mr1555_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607991416	1.12E-07	5.29E-11	mr1668_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607991416	NA	2.21E-09	mr1709_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607991416	8.12E-09	3.00E-10	mr1754_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607991416	NA	1.79E-09	mr1819_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607991416	4.17E-06	NA	mr1965_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607991416	3.58E-06	NA	mr1980_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607991416	1.97E-06	5.39E-08	mr1982_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251