Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0607963440:

Variant ID: vg0607963440 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 7963440
Reference Allele: AAlternative Allele: C
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, C: 0.01, others allele: 0.00, population size: 295. )

Flanking Sequence (100 bp) in Reference Genome:


TATTTCGACCAAACCAACTCTGATTTTGGAAAGAGAGGGAAAAAAAAAACGAGTACCGAAGTGATTTCAAGGCGAGATTTATGACCTTGCTGATACATAC[A/C]
TTCGTGCATATACCGTATATATTAACTACTATACGTCCATGATGTTGGTCCATGCATTGTACAAAGGATGAGTCTTCTCTGCAATACTAATATTTAGCGT

Reverse complement sequence

ACGCTAAATATTAGTATTGCAGAGAAGACTCATCCTTTGTACAATGCATGGACCAACATCATGGACGTATAGTAGTTAATATATACGGTATATGCACGAA[T/G]
GTATGTATCAGCAAGGTCATAAATCTCGCCTTGAAATCACTTCGGTACTCGTTTTTTTTTTCCCTCTCTTTCCAAAATCAGAGTTGGTTTGGTCGAAATA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 76.40% 23.60% 0.00% 0.00% NA
All Indica  2759 98.50% 1.50% 0.00% 0.00% NA
All Japonica  1512 36.60% 63.40% 0.00% 0.00% NA
Aus  269 91.40% 8.60% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 97.40% 2.60% 0.00% 0.00% NA
Indica III  913 98.50% 1.50% 0.00% 0.00% NA
Indica Intermediate  786 98.10% 1.90% 0.00% 0.00% NA
Temperate Japonica  767 61.00% 39.00% 0.00% 0.00% NA
Tropical Japonica  504 4.40% 95.60% 0.00% 0.00% NA
Japonica Intermediate  241 26.60% 73.40% 0.00% 0.00% NA
VI/Aromatic  96 33.30% 66.70% 0.00% 0.00% NA
Intermediate  90 67.80% 32.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0607963440 A -> C LOC_Os06g14270.1 upstream_gene_variant ; 1505.0bp to feature; MODIFIER silent_mutation Average:95.349; most accessible tissue: Zhenshan97 flower, score: 96.989 N N N N
vg0607963440 A -> C LOC_Os06g14280.1 downstream_gene_variant ; 439.0bp to feature; MODIFIER silent_mutation Average:95.349; most accessible tissue: Zhenshan97 flower, score: 96.989 N N N N
vg0607963440 A -> C LOC_Os06g14270-LOC_Os06g14280 intergenic_region ; MODIFIER silent_mutation Average:95.349; most accessible tissue: Zhenshan97 flower, score: 96.989 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0607963440 A C 0.0 0.0 0.01 0.0 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0607963440 NA 7.12E-10 mr1322 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607963440 NA 1.23E-10 mr1623 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607963440 NA 3.21E-09 mr1648 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607963440 NA 8.79E-07 mr1057_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607963440 NA 2.41E-19 mr1195_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607963440 NA 1.39E-07 mr1195_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607963440 NA 3.30E-08 mr1408_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607963440 1.32E-06 NA mr1482_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607963440 3.85E-06 1.17E-27 mr1551_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607963440 NA 5.33E-08 mr1551_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607963440 8.80E-06 6.16E-18 mr1552_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607963440 7.85E-06 NA mr1580_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607963440 NA 1.95E-08 mr1600_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607963440 2.38E-06 NA mr1679_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607963440 NA 3.51E-13 mr1713_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607963440 NA 2.60E-10 mr1761_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607963440 NA 6.74E-13 mr1770_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607963440 NA 8.18E-09 mr1783_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607963440 NA 2.16E-09 mr1804_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607963440 4.13E-06 NA mr1825_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607963440 2.33E-06 NA mr1829_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607963440 NA 4.51E-09 mr1905_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607963440 NA 1.38E-18 mr1945_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607963440 NA 4.19E-09 mr1946_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607963440 NA 4.19E-09 mr1948_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607963440 NA 4.86E-06 mr1982_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251