Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0607445929:

Variant ID: vg0607445929 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 7445929
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.74, T: 0.27, others allele: 0.00, population size: 200. )

Flanking Sequence (100 bp) in Reference Genome:

GCTCCGAGATTGCTTCTAGATTAGTGGCTAGGTCCTTCTCAAGTTGATGTTGTCAGGAGGACGGGATCCGAATTCAGAAGGTGTAAAACTTCATCTCTTG[C/T]
CTTCTATGGACCGAAAGTAAAGTGGTGATTTAGGAATAGACTTGGAGAAGGTCTTGGTTATGTCCCTAGTCAAATTCTTTGATCTTTAAAGTACTTCATG

Reverse complement sequence

CATGAAGTACTTTAAAGATCAAAGAATTTGACTAGGGACATAACCAAGACCTTCTCCAAGTCTATTCCTAAATCACCACTTTACTTTCGGTCCATAGAAG[G/A]
CAAGAGATGAAGTTTTACACCTTCTGAATTCGGATCCCGTCCTCCTGACAACATCAACTTGAGAAGGACCTAGCCACTAATCTAGAAGCAATCTCGGAGC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	45.30%	5.50%	0.57%	48.58%	NA
All Indica	2759	11.00%	6.20%	0.94%	81.84%	NA
All Japonica	1512	98.70%	0.50%	0.00%	0.79%	NA
Aus	269	99.30%	0.40%	0.00%	0.37%	NA
Indica I	595	6.70%	18.30%	0.34%	74.62%	NA
Indica II	465	5.20%	1.10%	1.51%	92.26%	NA
Indica III	913	13.60%	0.90%	0.66%	84.88%	NA
Indica Intermediate	786	14.80%	6.20%	1.40%	77.61%	NA
Temperate Japonica	767	98.80%	0.50%	0.00%	0.65%	NA
Tropical Japonica	504	99.40%	0.00%	0.00%	0.60%	NA
Japonica Intermediate	241	96.70%	1.70%	0.00%	1.66%	NA
VI/Aromatic	96	25.00%	75.00%	0.00%	0.00%	NA
Intermediate	90	62.20%	8.90%	1.11%	27.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0607445929	C -> T	LOC_Os06g13500.1	upstream_gene_variant ; 2711.0bp to feature; MODIFIER	silent_mutation	Average:11.391; most accessible tissue: Callus, score: 69.812	N	N	N	N
vg0607445929	C -> T	LOC_Os06g13500-LOC_Os06g13510	intergenic_region ; MODIFIER	silent_mutation	Average:11.391; most accessible tissue: Callus, score: 69.812	N	N	N	N
vg0607445929	C -> DEL	N	N	silent_mutation	Average:11.391; most accessible tissue: Callus, score: 69.812	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0607445929	8.72E-06	5.58E-06	mr1123_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607445929	1.90E-06	3.84E-09	mr1220_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607445929	7.36E-06	2.52E-06	mr1220_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607445929	7.13E-07	7.14E-07	mr1367_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607445929	1.55E-06	1.55E-06	mr1384_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607445929	NA	7.89E-06	mr1405_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607445929	7.15E-06	NA	mr1469_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607445929	7.40E-06	NA	mr1538_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607445929	2.12E-07	1.03E-09	mr1547_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607445929	7.82E-06	8.21E-07	mr1547_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607445929	NA	1.15E-06	mr1597_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607445929	NA	9.86E-06	mr1638_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607445929	NA	1.54E-06	mr1863_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607445929	NA	3.39E-06	mr1936_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251