Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0607348572:

Variant ID: vg0607348572 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 7348572
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 113. )

Flanking Sequence (100 bp) in Reference Genome:


TAGAACCGACACATATGTTTGACAGCTATATAGGTACTGATTATTTAAGTGGGTCCTCCAATGTCTACTTCCGGGAGTGAATGTCTCAAAAGTATTGGCT[C/T]
TAAACTGGGCCTCGGAACCAACCACTATGATGGGATAGAATAAAGGTAAATTTTTGCTACGGGACATTGAGATTTCGTTGTTTTAGCTATAAGACGTTGC

Reverse complement sequence

GCAACGTCTTATAGCTAAAACAACGAAATCTCAATGTCCCGTAGCAAAAATTTACCTTTATTCTATCCCATCATAGTGGTTGGTTCCGAGGCCCAGTTTA[G/A]
AGCCAATACTTTTGAGACATTCACTCCCGGAAGTAGACATTGGAGGACCCACTTAAATAATCAGTACCTATATAGCTGTCAAACATATGTGTCGGTTCTA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 86.30% 4.40% 1.29% 8.04% NA
All Indica  2759 80.10% 7.20% 2.07% 10.62% NA
All Japonica  1512 99.40% 0.40% 0.00% 0.20% NA
Aus  269 69.50% 0.00% 1.12% 29.37% NA
Indica I  595 94.50% 0.20% 2.52% 2.86% NA
Indica II  465 79.40% 15.50% 4.09% 1.08% NA
Indica III  913 73.80% 4.40% 0.22% 21.58% NA
Indica Intermediate  786 77.00% 10.90% 2.67% 9.41% NA
Temperate Japonica  767 99.50% 0.50% 0.00% 0.00% NA
Tropical Japonica  504 99.40% 0.20% 0.00% 0.40% NA
Japonica Intermediate  241 99.20% 0.40% 0.00% 0.41% NA
VI/Aromatic  96 96.90% 0.00% 0.00% 3.12% NA
Intermediate  90 95.60% 1.10% 1.11% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0607348572 C -> T LOC_Os06g13350.1 upstream_gene_variant ; 3659.0bp to feature; MODIFIER silent_mutation Average:89.864; most accessible tissue: Zhenshan97 root, score: 97.396 N N N N
vg0607348572 C -> T LOC_Os06g13360.1 intron_variant ; MODIFIER silent_mutation Average:89.864; most accessible tissue: Zhenshan97 root, score: 97.396 N N N N
vg0607348572 C -> DEL N N silent_mutation Average:89.864; most accessible tissue: Zhenshan97 root, score: 97.396 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0607348572 C T 0.0 -0.01 -0.01 0.01 0.01 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0607348572 1.31E-06 NA mr1970 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607348572 NA 2.57E-08 mr1970 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607348572 NA 6.20E-07 mr1973 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607348572 3.19E-06 1.37E-10 mr1310_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607348572 NA 1.33E-07 mr1498_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607348572 NA 1.11E-06 mr1551_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607348572 NA 7.04E-07 mr1552_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607348572 NA 4.12E-06 mr1679_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607348572 NA 2.98E-06 mr1691_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607348572 NA 8.38E-06 mr1720_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607348572 NA 4.70E-07 mr1733_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607348572 NA 3.95E-06 mr1896_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607348572 NA 2.58E-07 mr1951_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607348572 NA 7.57E-08 mr1951_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607348572 NA 2.22E-07 mr1970_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607348572 NA 5.03E-07 mr1973_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251