Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0605309496:

Variant ID: vg0605309496 (JBrowse)Variation Type: INDEL
Chromosome: chr06Position: 5309496
Reference Allele: GAAAlternative Allele: G
Primary Allele: GAASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATTTGGGGGGACTATGTTGTAATACCCTAGAAAAATGTTGTTAGGTGAGGCATCCTGCAGCAACGTGGCCTTCATTGTATCCATCAGGAGACAGGATTTT[GAA/G]
AAAGGGGGGGGGGGGGAAGGTGATTGATTGGCTCGTTGAATTTTTGATGATTTTTATAATGTCTATTTCATAGTATTAATAGTAGTATGCACAAGAAATA

Reverse complement sequence

TATTTCTTGTGCATACTACTATTAATACTATGAAATAGACATTATAAAAATCATCAAAAATTCAACGAGCCAATCAATCACCTTCCCCCCCCCCCCCTTT[TTC/C]
AAAATCCTGTCTCCTGATGGATACAATGAAGGCCACGTTGCTGCAGGATGCCTCACCTAACAACATTTTTCTAGGGTATTACAACATAGTCCCCCCAAAT

Allele Frequencies:

Populations Population SizeFrequency of GAA(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 89.00% 1.50% 9.42% 0.08% NA
All Indica  2759 82.40% 2.20% 15.33% 0.11% NA
All Japonica  1512 99.90% 0.00% 0.07% 0.00% NA
Aus  269 89.60% 3.70% 6.32% 0.37% NA
Indica I  595 71.30% 0.00% 28.74% 0.00% NA
Indica II  465 99.10% 0.00% 0.43% 0.43% NA
Indica III  913 78.10% 4.60% 17.31% 0.00% NA
Indica Intermediate  786 85.90% 2.30% 11.70% 0.13% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.00% 0.20% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 93.30% 2.20% 4.44% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0605309496 GAA -> G LOC_Os06g10320.1 downstream_gene_variant ; 2766.0bp to feature; MODIFIER silent_mutation Average:75.243; most accessible tissue: Minghui63 young leaf, score: 85.028 N N N N
vg0605309496 GAA -> G LOC_Os06g10330.1 downstream_gene_variant ; 1750.0bp to feature; MODIFIER silent_mutation Average:75.243; most accessible tissue: Minghui63 young leaf, score: 85.028 N N N N
vg0605309496 GAA -> G LOC_Os06g10340.1 intron_variant ; MODIFIER silent_mutation Average:75.243; most accessible tissue: Minghui63 young leaf, score: 85.028 N N N N
vg0605309496 GAA -> DEL N N silent_mutation Average:75.243; most accessible tissue: Minghui63 young leaf, score: 85.028 N N N N