\
| Variant ID: vg0604356746 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 4356746 |
| Reference Allele: T | Alternative Allele: A |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
GTCTTATTCAAAAAATTTTAGAATTATTATTTATTTTTTTTACTTACTTTATTATCCAAAGTACTTTAAGCATAACTTTTCGTTTTTTATATTTGCATAA[T/A]
TTTTTTTAATAAGACGAGTGGTCAAACACTATAAGTAAAAACTCAAAATCTCTTATATTATGGGACGGAGGGAGTACTAGAGTAATTACTAGCTATAAGT
ACTTATAGCTAGTAATTACTCTAGTACTCCCTCCGTCCCATAATATAAGAGATTTTGAGTTTTTACTTATAGTGTTTGACCACTCGTCTTATTAAAAAAA[A/T]
TTATGCAAATATAAAAAACGAAAAGTTATGCTTAAAGTACTTTGGATAATAAAGTAAGTAAAAAAAATAAATAATAATTCTAAAATTTTTTGAATAAGAC
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 13.70% | 7.60% | 0.40% | 78.31% | NA |
| All Indica | 2759 | 2.00% | 0.50% | 0.51% | 96.96% | NA |
| All Japonica | 1512 | 37.00% | 22.10% | 0.00% | 40.94% | NA |
| Aus | 269 | 9.30% | 0.00% | 0.74% | 89.96% | NA |
| Indica I | 595 | 3.00% | 0.20% | 1.01% | 95.80% | NA |
| Indica II | 465 | 2.40% | 2.40% | 0.65% | 94.62% | NA |
| Indica III | 913 | 0.40% | 0.10% | 0.00% | 99.45% | NA |
| Indica Intermediate | 786 | 2.80% | 0.30% | 0.64% | 96.31% | NA |
| Temperate Japonica | 767 | 62.80% | 32.70% | 0.00% | 4.43% | NA |
| Tropical Japonica | 504 | 3.60% | 6.20% | 0.00% | 90.28% | NA |
| Japonica Intermediate | 241 | 24.50% | 21.60% | 0.00% | 53.94% | NA |
| VI/Aromatic | 96 | 0.00% | 6.20% | 0.00% | 93.75% | NA |
| Intermediate | 90 | 7.80% | 5.60% | 3.33% | 83.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0604356746 | T -> A | LOC_Os06g08720.1 | upstream_gene_variant ; 3362.0bp to feature; MODIFIER | silent_mutation | Average:42.378; most accessible tissue: Zhenshan97 flag leaf, score: 63.101 | N | N | N | N |
| vg0604356746 | T -> A | LOC_Os06g08720.2 | upstream_gene_variant ; 3362.0bp to feature; MODIFIER | silent_mutation | Average:42.378; most accessible tissue: Zhenshan97 flag leaf, score: 63.101 | N | N | N | N |
| vg0604356746 | T -> A | LOC_Os06g08720.3 | upstream_gene_variant ; 3362.0bp to feature; MODIFIER | silent_mutation | Average:42.378; most accessible tissue: Zhenshan97 flag leaf, score: 63.101 | N | N | N | N |
| vg0604356746 | T -> A | LOC_Os06g08720-LOC_Os06g08730 | intergenic_region ; MODIFIER | silent_mutation | Average:42.378; most accessible tissue: Zhenshan97 flag leaf, score: 63.101 | N | N | N | N |
| vg0604356746 | T -> DEL | N | N | silent_mutation | Average:42.378; most accessible tissue: Zhenshan97 flag leaf, score: 63.101 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0604356746 | NA | 2.29E-19 | Awn_length | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0604356746 | NA | 7.12E-13 | Awn_length | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0604356746 | 4.28E-12 | NA | mr1137 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604356746 | 1.99E-11 | 4.22E-09 | mr1137 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604356746 | 2.55E-10 | NA | mr1617 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604356746 | 1.03E-09 | 9.67E-09 | mr1617 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604356746 | 1.19E-13 | NA | mr1137_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604356746 | 1.72E-11 | 9.91E-11 | mr1137_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604356746 | 1.63E-07 | NA | mr1617_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604356746 | 6.77E-07 | 1.90E-07 | mr1617_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604356746 | NA | 1.17E-06 | mr1723_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |