\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0604356746:

Variant ID: vg0604356746 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 4356746
Reference Allele: TAlternative Allele: A
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GTCTTATTCAAAAAATTTTAGAATTATTATTTATTTTTTTTACTTACTTTATTATCCAAAGTACTTTAAGCATAACTTTTCGTTTTTTATATTTGCATAA[T/A]
TTTTTTTAATAAGACGAGTGGTCAAACACTATAAGTAAAAACTCAAAATCTCTTATATTATGGGACGGAGGGAGTACTAGAGTAATTACTAGCTATAAGT

Reverse complement sequence

ACTTATAGCTAGTAATTACTCTAGTACTCCCTCCGTCCCATAATATAAGAGATTTTGAGTTTTTACTTATAGTGTTTGACCACTCGTCTTATTAAAAAAA[A/T]
TTATGCAAATATAAAAAACGAAAAGTTATGCTTAAAGTACTTTGGATAATAAAGTAAGTAAAAAAAATAAATAATAATTCTAAAATTTTTTGAATAAGAC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 13.70% 7.60% 0.40% 78.31% NA
All Indica  2759 2.00% 0.50% 0.51% 96.96% NA
All Japonica  1512 37.00% 22.10% 0.00% 40.94% NA
Aus  269 9.30% 0.00% 0.74% 89.96% NA
Indica I  595 3.00% 0.20% 1.01% 95.80% NA
Indica II  465 2.40% 2.40% 0.65% 94.62% NA
Indica III  913 0.40% 0.10% 0.00% 99.45% NA
Indica Intermediate  786 2.80% 0.30% 0.64% 96.31% NA
Temperate Japonica  767 62.80% 32.70% 0.00% 4.43% NA
Tropical Japonica  504 3.60% 6.20% 0.00% 90.28% NA
Japonica Intermediate  241 24.50% 21.60% 0.00% 53.94% NA
VI/Aromatic  96 0.00% 6.20% 0.00% 93.75% NA
Intermediate  90 7.80% 5.60% 3.33% 83.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0604356746 T -> A LOC_Os06g08720.1 upstream_gene_variant ; 3362.0bp to feature; MODIFIER silent_mutation Average:42.378; most accessible tissue: Zhenshan97 flag leaf, score: 63.101 N N N N
vg0604356746 T -> A LOC_Os06g08720.2 upstream_gene_variant ; 3362.0bp to feature; MODIFIER silent_mutation Average:42.378; most accessible tissue: Zhenshan97 flag leaf, score: 63.101 N N N N
vg0604356746 T -> A LOC_Os06g08720.3 upstream_gene_variant ; 3362.0bp to feature; MODIFIER silent_mutation Average:42.378; most accessible tissue: Zhenshan97 flag leaf, score: 63.101 N N N N
vg0604356746 T -> A LOC_Os06g08720-LOC_Os06g08730 intergenic_region ; MODIFIER silent_mutation Average:42.378; most accessible tissue: Zhenshan97 flag leaf, score: 63.101 N N N N
vg0604356746 T -> DEL N N silent_mutation Average:42.378; most accessible tissue: Zhenshan97 flag leaf, score: 63.101 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0604356746 NA 2.29E-19 Awn_length All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0604356746 NA 7.12E-13 Awn_length Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0604356746 4.28E-12 NA mr1137 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604356746 1.99E-11 4.22E-09 mr1137 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604356746 2.55E-10 NA mr1617 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604356746 1.03E-09 9.67E-09 mr1617 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604356746 1.19E-13 NA mr1137_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604356746 1.72E-11 9.91E-11 mr1137_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604356746 1.63E-07 NA mr1617_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604356746 6.77E-07 1.90E-07 mr1617_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604356746 NA 1.17E-06 mr1723_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251