\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0604305910:

Variant ID: vg0604305910 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 4305910
Reference Allele: TAlternative Allele: C,G
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTGTCATCCACGCGATCCGATTTAATTAGATTCTGTCCGCCGTCCCGGTATTTTCGCATCACAGATCTCGGCCTCCGTACTGAACAAAGAATTGATACTC[T/C,G]
CTCTGTATTTTAATATATGAAGCCATTAACTTTTTGATTAACGTTTGACTATTCGTCTTATTCAAAATTTTTGTGTAAATATAAAAATATTTATGTCATG

Reverse complement sequence

CATGACATAAATATTTTTATATTTACACAAAAATTTTGAATAAGACGAATAGTCAAACGTTAATCAAAAAGTTAATGGCTTCATATATTAAAATACAGAG[A/G,C]
GAGTATCAATTCTTTGTTCAGTACGGAGGCCGAGATCTGTGATGCGAAAATACCGGGACGGCGGACAGAATCTAATTAAATCGGATCGCGTGGATGACAG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 78.30% 11.90% 4.02% 3.41% G: 2.41%
All Indica  2759 89.30% 0.30% 5.11% 4.02% G: 1.23%
All Japonica  1512 58.20% 36.30% 2.45% 2.65% G: 0.40%
Aus  269 72.50% 0.00% 1.12% 0.00% G: 26.39%
Indica I  595 88.40% 0.30% 8.40% 2.86% NA
Indica II  465 91.20% 0.00% 6.02% 2.80% NA
Indica III  913 89.00% 0.10% 3.50% 6.24% G: 1.10%
Indica Intermediate  786 89.20% 0.80% 3.94% 3.05% G: 3.05%
Temperate Japonica  767 37.40% 61.90% 0.39% 0.13% G: 0.13%
Tropical Japonica  504 85.30% 3.00% 4.56% 6.75% G: 0.40%
Japonica Intermediate  241 67.60% 24.50% 4.56% 2.07% G: 1.24%
VI/Aromatic  96 84.40% 0.00% 5.21% 9.38% G: 1.04%
Intermediate  90 88.90% 3.30% 4.44% 1.11% G: 2.22%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0604305910 T -> C LOC_Os06g08640.1 upstream_gene_variant ; 2789.0bp to feature; MODIFIER silent_mutation Average:31.835; most accessible tissue: Callus, score: 50.954 N N N N
vg0604305910 T -> C LOC_Os06g08640-LOC_Os06g08650 intergenic_region ; MODIFIER silent_mutation Average:31.835; most accessible tissue: Callus, score: 50.954 N N N N
vg0604305910 T -> G LOC_Os06g08640.1 upstream_gene_variant ; 2789.0bp to feature; MODIFIER silent_mutation Average:31.835; most accessible tissue: Callus, score: 50.954 N N N N
vg0604305910 T -> G LOC_Os06g08640-LOC_Os06g08650 intergenic_region ; MODIFIER silent_mutation Average:31.835; most accessible tissue: Callus, score: 50.954 N N N N
vg0604305910 T -> DEL N N silent_mutation Average:31.835; most accessible tissue: Callus, score: 50.954 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0604305910 4.45E-08 NA Awn_length All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0604305910 3.04E-15 2.16E-35 mr1115 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604305910 9.67E-11 2.16E-21 mr1115 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604305910 2.22E-34 3.84E-72 mr1137 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604305910 3.63E-21 1.36E-35 mr1137 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604305910 NA 1.15E-06 mr1183 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604305910 NA 2.05E-06 mr1330 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604305910 NA 1.98E-06 mr1503 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604305910 NA 3.56E-06 mr1521 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604305910 NA 4.84E-06 mr1530 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604305910 6.26E-10 5.24E-29 mr1611 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604305910 4.06E-07 2.16E-15 mr1611 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604305910 3.71E-28 2.82E-57 mr1617 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604305910 5.52E-17 2.30E-26 mr1617 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604305910 3.54E-13 1.16E-31 mr1920 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604305910 8.35E-09 8.33E-16 mr1920 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604305910 NA 4.20E-06 mr1937 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604305910 9.75E-15 1.34E-36 mr1115_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604305910 4.82E-10 3.99E-20 mr1115_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604305910 1.37E-40 1.91E-81 mr1137_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604305910 1.19E-20 7.21E-34 mr1137_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604305910 NA 4.42E-06 mr1182_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604305910 2.59E-08 NA mr1241_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604305910 4.90E-10 1.44E-29 mr1611_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604305910 1.83E-07 1.12E-15 mr1611_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604305910 2.32E-19 2.98E-46 mr1617_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604305910 4.49E-10 4.86E-17 mr1617_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251