Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0600634198:

Variant ID: vg0600634198 (JBrowse)	Variation Type: INDEL
Chromosome: chr06	Position: 634198
Reference Allele: A	Alternative Allele: ATACAG
Primary Allele: A	Secondary Allele: ATACAG

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TGTGTTCATGGTAATCATCATCCATTAACTGAAGAAAAACCTTTGAATCTTATAGATTTTTTTTGCAGTAATTAATAACTGGTAAAATGACCAAAGAACA[A/ATACAG]
TATTTATCCACAACATTGGGGGTCGGAGAATTAAACACCGACCCCCCGGTTGTGTCCAGAACTCCAGGAAATGATTTTATAAGCTCACACAACACAACTT

Reverse complement sequence

AAGTTGTGTTGTGTGAGCTTATAAAATCATTTCCTGGAGTTCTGGACACAACCGGGGGGTCGGTGTTTAATTCTCCGACCCCCAATGTTGTGGATAAATA[T/CTGTAT]
TGTTCTTTGGTCATTTTACCAGTTATTAATTACTGCAAAAAAAATCTATAAGATTCAAAGGTTTTTCTTCAGTTAATGGATGATGATTACCATGAACACA

Allele Frequencies:

Allele Effect:

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.