\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0528458618:

Variant ID: vg0528458618 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 28458618
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.93, A: 0.07, others allele: 0.00, population size: 163. )

Flanking Sequence (100 bp) in Reference Genome:


AATCTAGTTAGCGGCTCTCTACTGTGTAGAGATGGTTTTAGACTTGTGTTTGAATCCAATAAATGTGTCGTATCTAAATATGGAACTTTTATTGGAAAAG[A/G]
TTATGATAGCGGAGGTCTGTTCCGTTTTTCTTTGGATGACATGTGTAATAATAATAATAATGTTGTGAACCATATTAGCGAGAATGATGACTCCAATGTG

Reverse complement sequence

CACATTGGAGTCATCATTCTCGCTAATATGGTTCACAACATTATTATTATTATTACACATGTCATCCAAAGAAAAACGGAACAGACCTCCGCTATCATAA[T/C]
CTTTTCCAATAAAAGTTCCATATTTAGATACGACACATTTATTGGATTCAAACACAAGTCTAAAACCATCTCTACACAGTAGAGAGCCGCTAACTAGATT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 22.60% 19.30% 57.81% 0.34% NA
All Indica  2759 3.60% 23.20% 73.03% 0.22% NA
All Japonica  1512 59.70% 2.40% 37.17% 0.66% NA
Aus  269 2.60% 77.70% 19.70% 0.00% NA
Indica I  595 2.70% 14.50% 82.69% 0.17% NA
Indica II  465 5.40% 11.00% 82.80% 0.86% NA
Indica III  913 2.20% 28.60% 69.11% 0.11% NA
Indica Intermediate  786 4.80% 30.70% 64.50% 0.00% NA
Temperate Japonica  767 97.90% 0.30% 1.83% 0.00% NA
Tropical Japonica  504 4.00% 5.60% 88.69% 1.79% NA
Japonica Intermediate  241 54.80% 2.90% 41.91% 0.41% NA
VI/Aromatic  96 36.50% 10.40% 53.12% 0.00% NA
Intermediate  90 25.60% 17.80% 56.67% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0528458618 A -> DEL LOC_Os05g49600.1 N frameshift_variant Average:17.895; most accessible tissue: Zhenshan97 root, score: 22.162 N N N N
vg0528458618 A -> G LOC_Os05g49600.1 missense_variant ; p.Asp301Gly; MODERATE nonsynonymous_codon ; D301G Average:17.895; most accessible tissue: Zhenshan97 root, score: 22.162 possibly damaging -1.614 TOLERATED 1.00

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0528458618 NA 4.99E-15 mr1228 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528458618 NA 2.34E-11 mr1241 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528458618 NA 9.55E-08 mr1382 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528458618 NA 3.22E-06 mr1518 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528458618 NA 1.53E-06 mr1676 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528458618 NA 1.30E-14 mr1031_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528458618 NA 2.00E-07 mr1090_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528458618 NA 2.10E-08 mr1189_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528458618 NA 1.88E-60 mr1241_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528458618 NA 6.65E-13 mr1241_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528458618 NA 2.58E-06 mr1268_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528458618 NA 1.81E-07 mr1338_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528458618 NA 3.16E-10 mr1454_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528458618 NA 2.78E-10 mr1471_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528458618 NA 1.38E-09 mr1864_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528458618 NA 4.61E-06 mr1870_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251