Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0527223548:

Variant ID: vg0527223548 (JBrowse)	Variation Type: INDEL
Chromosome: chr05	Position: 27223548
Reference Allele: GTCGTCA	Alternative Allele: G
Primary Allele: GTCGTCA	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GGTGCGAGAGGGCTGGCGGGGTGGCGGCGCGCAAGGTCACCGAGATGGTGAGGCCGGTGCTCGTCGTGGAAGTGGCGGTGGTGGCGTCGGGCCGGTGGTC[GTCGTCA/G]
TCGTCGTCGTCGTCGGCGACGTGGCCCCAGAGCTCGAGCAGGACGACGCTTGGGATATCGCCCTTGCCCTCGCCGCTTCCGCTTGCCATGGAGGCAGCAG

Reverse complement sequence

CTGCTGCCTCCATGGCAAGCGGAAGCGGCGAGGGCAAGGGCGATATCCCAAGCGTCGTCCTGCTCGAGCTCTGGGGCCACGTCGCCGACGACGACGACGA[TGACGAC/C]
GACCACCGGCCCGACGCCACCACCGCCACTTCCACGACGAGCACCGGCCTCACCATCTCGGTGACCTTGCGCGCCGCCACCCCGCCAGCCCTCTCGCACC

Allele Frequencies:

Populations	Population Size	Frequency of GTCGTCA(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	89.10%	10.70%	0.13%	0.06%	NA
All Indica	2759	92.90%	6.90%	0.14%	0.11%	NA
All Japonica	1512	80.70%	19.30%	0.00%	0.00%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	99.00%	0.80%	0.00%	0.17%	NA
Indica II	465	69.50%	29.70%	0.43%	0.43%	NA
Indica III	913	99.80%	0.20%	0.00%	0.00%	NA
Indica Intermediate	786	94.00%	5.70%	0.25%	0.00%	NA
Temperate Japonica	767	99.10%	0.90%	0.00%	0.00%	NA
Tropical Japonica	504	57.50%	42.50%	0.00%	0.00%	NA
Japonica Intermediate	241	70.50%	29.50%	0.00%	0.00%	NA
VI/Aromatic	96	93.80%	6.20%	0.00%	0.00%	NA
Intermediate	90	81.10%	16.70%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0527223548	GTCGTCA -> DEL	LOC_Os05g47520.1	N	frameshift_variant	Average:94.432; most accessible tissue: Zhenshan97 flower, score: 97.933	N	N	N	N
vg0527223548	GTCGTCA -> G	LOC_Os05g47520.1	disruptive_inframe_deletion ; p.Asp31_Asp32del; MODERATE	inframe_variant	Average:94.432; most accessible tissue: Zhenshan97 flower, score: 97.933	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0527223548	GTCGT*	G	-0.08	-0.09	-0.09	0.0	-0.03	-0.02