\
| Variant ID: vg0526905981 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 26905981 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.03, others allele: 0.00, population size: 120. )
TCATTGTCCTAAGATGTATCACATCCACTCAAAATCTCATGTACAGATTTATTGTCCTAGGATATATCATATCCACTCAAAATCTCTTATATTATAGGAC[G/A]
GAGAGAGAATATATAATCCGCATAATAACTTACTCCCTTCGTCCCAAAAAAAAATCAATCTAGTATTGGATGAGACGTTTTCTAGTACAAAGAATCTGAA
TTCAGATTCTTTGTACTAGAAAACGTCTCATCCAATACTAGATTGATTTTTTTTTGGGACGAAGGGAGTAAGTTATTATGCGGATTATATATTCTCTCTC[C/T]
GTCCTATAATATAAGAGATTTTGAGTGGATATGATATATCCTAGGACAATAAATCTGTACATGAGATTTTGAGTGGATGTGATACATCTTAGGACAATGA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 63.40% | 34.80% | 1.74% | 0.00% | NA |
| All Indica | 2759 | 86.00% | 12.10% | 1.85% | 0.00% | NA |
| All Japonica | 1512 | 29.00% | 69.50% | 1.46% | 0.00% | NA |
| Aus | 269 | 19.00% | 80.30% | 0.74% | 0.00% | NA |
| Indica I | 595 | 83.20% | 10.60% | 6.22% | 0.00% | NA |
| Indica II | 465 | 64.70% | 33.30% | 1.94% | 0.00% | NA |
| Indica III | 913 | 97.00% | 3.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 87.90% | 11.50% | 0.64% | 0.00% | NA |
| Temperate Japonica | 767 | 50.70% | 47.60% | 1.69% | 0.00% | NA |
| Tropical Japonica | 504 | 2.40% | 97.20% | 0.40% | 0.00% | NA |
| Japonica Intermediate | 241 | 15.80% | 81.30% | 2.90% | 0.00% | NA |
| VI/Aromatic | 96 | 89.60% | 10.40% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 53.30% | 38.90% | 7.78% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0526905981 | G -> A | LOC_Os05g46430.1 | upstream_gene_variant ; 970.0bp to feature; MODIFIER | silent_mutation | Average:63.204; most accessible tissue: Minghui63 panicle, score: 77.956 | N | N | N | N |
| vg0526905981 | G -> A | LOC_Os05g46430.2 | upstream_gene_variant ; 970.0bp to feature; MODIFIER | silent_mutation | Average:63.204; most accessible tissue: Minghui63 panicle, score: 77.956 | N | N | N | N |
| vg0526905981 | G -> A | LOC_Os05g46420.1 | downstream_gene_variant ; 4444.0bp to feature; MODIFIER | silent_mutation | Average:63.204; most accessible tissue: Minghui63 panicle, score: 77.956 | N | N | N | N |
| vg0526905981 | G -> A | LOC_Os05g46440.1 | downstream_gene_variant ; 1224.0bp to feature; MODIFIER | silent_mutation | Average:63.204; most accessible tissue: Minghui63 panicle, score: 77.956 | N | N | N | N |
| vg0526905981 | G -> A | LOC_Os05g46450.1 | downstream_gene_variant ; 1742.0bp to feature; MODIFIER | silent_mutation | Average:63.204; most accessible tissue: Minghui63 panicle, score: 77.956 | N | N | N | N |
| vg0526905981 | G -> A | LOC_Os05g46430-LOC_Os05g46440 | intergenic_region ; MODIFIER | silent_mutation | Average:63.204; most accessible tissue: Minghui63 panicle, score: 77.956 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0526905981 | 1.68E-06 | 1.52E-10 | mr1013 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526905981 | 8.05E-06 | 5.30E-11 | mr1031 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526905981 | NA | 3.58E-07 | mr1034 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526905981 | NA | 2.80E-10 | mr1056 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526905981 | NA | 9.62E-10 | mr1163 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526905981 | NA | 5.58E-06 | mr1729 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526905981 | NA | 1.46E-08 | mr1010_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526905981 | NA | 3.76E-06 | mr1011_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526905981 | NA | 9.29E-07 | mr1013_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |