\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0526905981:

Variant ID: vg0526905981 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 26905981
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.03, others allele: 0.00, population size: 120. )

Flanking Sequence (100 bp) in Reference Genome:


TCATTGTCCTAAGATGTATCACATCCACTCAAAATCTCATGTACAGATTTATTGTCCTAGGATATATCATATCCACTCAAAATCTCTTATATTATAGGAC[G/A]
GAGAGAGAATATATAATCCGCATAATAACTTACTCCCTTCGTCCCAAAAAAAAATCAATCTAGTATTGGATGAGACGTTTTCTAGTACAAAGAATCTGAA

Reverse complement sequence

TTCAGATTCTTTGTACTAGAAAACGTCTCATCCAATACTAGATTGATTTTTTTTTGGGACGAAGGGAGTAAGTTATTATGCGGATTATATATTCTCTCTC[C/T]
GTCCTATAATATAAGAGATTTTGAGTGGATATGATATATCCTAGGACAATAAATCTGTACATGAGATTTTGAGTGGATGTGATACATCTTAGGACAATGA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 63.40% 34.80% 1.74% 0.00% NA
All Indica  2759 86.00% 12.10% 1.85% 0.00% NA
All Japonica  1512 29.00% 69.50% 1.46% 0.00% NA
Aus  269 19.00% 80.30% 0.74% 0.00% NA
Indica I  595 83.20% 10.60% 6.22% 0.00% NA
Indica II  465 64.70% 33.30% 1.94% 0.00% NA
Indica III  913 97.00% 3.00% 0.00% 0.00% NA
Indica Intermediate  786 87.90% 11.50% 0.64% 0.00% NA
Temperate Japonica  767 50.70% 47.60% 1.69% 0.00% NA
Tropical Japonica  504 2.40% 97.20% 0.40% 0.00% NA
Japonica Intermediate  241 15.80% 81.30% 2.90% 0.00% NA
VI/Aromatic  96 89.60% 10.40% 0.00% 0.00% NA
Intermediate  90 53.30% 38.90% 7.78% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0526905981 G -> A LOC_Os05g46430.1 upstream_gene_variant ; 970.0bp to feature; MODIFIER silent_mutation Average:63.204; most accessible tissue: Minghui63 panicle, score: 77.956 N N N N
vg0526905981 G -> A LOC_Os05g46430.2 upstream_gene_variant ; 970.0bp to feature; MODIFIER silent_mutation Average:63.204; most accessible tissue: Minghui63 panicle, score: 77.956 N N N N
vg0526905981 G -> A LOC_Os05g46420.1 downstream_gene_variant ; 4444.0bp to feature; MODIFIER silent_mutation Average:63.204; most accessible tissue: Minghui63 panicle, score: 77.956 N N N N
vg0526905981 G -> A LOC_Os05g46440.1 downstream_gene_variant ; 1224.0bp to feature; MODIFIER silent_mutation Average:63.204; most accessible tissue: Minghui63 panicle, score: 77.956 N N N N
vg0526905981 G -> A LOC_Os05g46450.1 downstream_gene_variant ; 1742.0bp to feature; MODIFIER silent_mutation Average:63.204; most accessible tissue: Minghui63 panicle, score: 77.956 N N N N
vg0526905981 G -> A LOC_Os05g46430-LOC_Os05g46440 intergenic_region ; MODIFIER silent_mutation Average:63.204; most accessible tissue: Minghui63 panicle, score: 77.956 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0526905981 1.68E-06 1.52E-10 mr1013 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526905981 8.05E-06 5.30E-11 mr1031 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526905981 NA 3.58E-07 mr1034 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526905981 NA 2.80E-10 mr1056 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526905981 NA 9.62E-10 mr1163 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526905981 NA 5.58E-06 mr1729 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526905981 NA 1.46E-08 mr1010_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526905981 NA 3.76E-06 mr1011_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526905981 NA 9.29E-07 mr1013_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251