Variant ID: vg0525210558 (JBrowse) | Variation Type: SNP |
Chromosome: chr05 | Position: 25210558 |
Reference Allele: G | Alternative Allele: A |
Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.01, others allele: 0.00, population size: 259. )
CTGGATTGGCCAGCCAGTCAGGATGTAGGACTTCCTTGATGAAGCCTGCTGCTAACAGCTTGGTCAATTCCTCCTTGATCGCATCCTTCCTATCCTGTGC[G/A]
AAATGGCGGAGTCGTTGCTCGATAGGTTTAGCATCTTCCTTAACATGTAAAGAGTGCTCAATCACCTCTCTAGGAATACCAGGCATATCAGATGGTTTCC
GGAAACCATCTGATATGCCTGGTATTCCTAGAGAGGTGATTGAGCACTCTTTACATGTTAAGGAAGATGCTAAACCTATCGAGCAACGACTCCGCCATTT[C/T]
GCACAGGATAGGAAGGATGCGATCAAGGAGGAATTGACCAAGCTGTTAGCAGCAGGCTTCATCAAGGAAGTCCTACATCCTGACTGGCTGGCCAATCCAG
Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 92.90% | 7.10% | 0.02% | 0.00% | NA |
All Indica | 2759 | 97.40% | 2.60% | 0.00% | 0.00% | NA |
All Japonica | 1512 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Aus | 269 | 5.60% | 94.10% | 0.37% | 0.00% | NA |
Indica I | 595 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
Indica II | 465 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
Indica III | 913 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
Indica Intermediate | 786 | 93.80% | 6.20% | 0.00% | 0.00% | NA |
Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
VI/Aromatic | 96 | 95.80% | 4.20% | 0.00% | 0.00% | NA |
Intermediate | 90 | 92.20% | 7.80% | 0.00% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0525210558 | G -> A | LOC_Os05g43350.1 | synonymous_variant ; p.Phe797Phe; LOW | synonymous_codon | Average:38.508; most accessible tissue: Minghui63 young leaf, score: 54.11 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0525210558 | NA | 5.64E-08 | mr1004 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0525210558 | NA | 1.46E-07 | mr1006 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0525210558 | NA | 2.75E-06 | mr1007 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0525210558 | 1.78E-06 | NA | mr1010 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0525210558 | NA | 6.57E-08 | mr1028 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0525210558 | NA | 1.80E-07 | mr1052 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0525210558 | NA | 3.53E-06 | mr1073 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0525210558 | NA | 4.30E-25 | mr1095 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0525210558 | NA | 1.12E-33 | mr1098 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0525210558 | NA | 3.04E-32 | mr1099 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/