Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0525142447:

Variant ID: vg0525142447 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 25142447
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, T: 0.00, others allele: 0.00, population size: 268. )

Flanking Sequence (100 bp) in Reference Genome:


CGAAGAACTCTTAAAGTGGATGACGACTTTATTGATTCTATCTGTGTTTACAAAGTGCACCAACAGCACTCCTTACAAAAATTTCAACTAAACTCGAAAC[C/A]
CTAACTCAAAACTCAACTCAATTGCTCTCAAAAGCGATACCGGGAAGCCTCACGCTCCCCCACTATTTATACCCAAGGTAGGCAGCCTAAAGCCACGAAC

Reverse complement sequence

GTTCGTGGCTTTAGGCTGCCTACCTTGGGTATAAATAGTGGGGGAGCGTGAGGCTTCCCGGTATCGCTTTTGAGAGCAATTGAGTTGAGTTTTGAGTTAG[G/T]
GTTTCGAGTTTAGTTGAAATTTTTGTAAGGAGTGCTGTTGGTGCACTTTGTAAACACAGATAGAATCAATAAAGTCGTCATCCACTTTAAGAGTTCTTCG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 93.00% 6.80% 0.21% 0.00% NA
All Indica  2759 97.30% 2.60% 0.04% 0.00% NA
All Japonica  1512 100.00% 0.00% 0.00% 0.00% NA
Aus  269 7.80% 88.80% 3.35% 0.00% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 99.40% 0.60% 0.00% 0.00% NA
Indica III  913 97.80% 2.20% 0.00% 0.00% NA
Indica Intermediate  786 93.60% 6.20% 0.13% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 94.80% 5.20% 0.00% 0.00% NA
Intermediate  90 94.40% 5.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0525142447 C -> A LOC_Os05g43220.1 downstream_gene_variant ; 4797.0bp to feature; MODIFIER silent_mutation Average:34.083; most accessible tissue: Zhenshan97 panicle, score: 54.901 N N N N
vg0525142447 C -> A LOC_Os05g43220-LOC_Os05g43230 intergenic_region ; MODIFIER silent_mutation Average:34.083; most accessible tissue: Zhenshan97 panicle, score: 54.901 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0525142447 NA 6.86E-07 mr1004 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525142447 NA 4.72E-07 mr1006 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525142447 1.86E-06 NA mr1013 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525142447 NA 2.30E-07 mr1052 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525142447 NA 1.43E-16 mr1113 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525142447 NA 5.32E-19 mr1114 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525142447 NA 3.62E-16 mr1119 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525142447 NA 1.58E-06 mr1207 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525142447 NA 3.07E-06 mr1230 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525142447 NA 2.97E-08 mr1262 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525142447 NA 4.22E-06 mr1286 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525142447 NA 2.05E-06 mr1320 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525142447 NA 2.02E-06 mr1331 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525142447 NA 2.67E-07 mr1365 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525142447 NA 3.01E-06 mr1397 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525142447 NA 9.61E-12 mr1409 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525142447 NA 1.99E-06 mr1438 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525142447 NA 1.38E-15 mr1496 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525142447 NA 5.84E-07 mr1545 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525142447 NA 1.53E-40 mr1550 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525142447 NA 6.18E-08 mr1556 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525142447 NA 4.57E-06 mr1596 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525142447 NA 1.03E-37 mr1757 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525142447 NA 1.80E-06 mr1774 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525142447 NA 9.42E-06 mr1236_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525142447 NA 1.03E-08 mr1860_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251