\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0525126223:

Variant ID: vg0525126223 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 25126223
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 277. )

Flanking Sequence (100 bp) in Reference Genome:


GAGCACCCGCAATGGTAAAGTAATGTGCTATCTATAAAACATGTACATCTCAGCAATAGACTAGATTAATAGTAAATCACTTCAATGGTATGTCTACATG[G/A]
GTATCTATAGCTCTCTAATTCATTGCCTCGTTTTTCTCTATAGACTATCTCTAAGTTAGTAGATAACTTTGCTCTCTCTCTTCATTTAATCTCTTCCAAG

Reverse complement sequence

CTTGGAAGAGATTAAATGAAGAGAGAGAGCAAAGTTATCTACTAACTTAGAGATAGTCTATAGAGAAAAACGAGGCAATGAATTAGAGAGCTATAGATAC[C/T]
CATGTAGACATACCATTGAAGTGATTTACTATTAATCTAGTCTATTGCTGAGATGTACATGTTTTATAGATAGCACATTACTTTACCATTGCGGGTGCTC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 96.80% 2.90% 0.28% 0.00% NA
All Indica  2759 96.10% 3.70% 0.18% 0.00% NA
All Japonica  1512 97.50% 2.00% 0.53% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 82.20% 16.80% 1.08% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 96.80% 3.20% 0.00% 0.00% NA
Temperate Japonica  767 99.70% 0.00% 0.26% 0.00% NA
Tropical Japonica  504 93.80% 5.00% 1.19% 0.00% NA
Japonica Intermediate  241 97.90% 2.10% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 97.80% 2.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0525126223 G -> A LOC_Os05g43210-LOC_Os05g43220 intergenic_region ; MODIFIER silent_mutation Average:52.042; most accessible tissue: Callus, score: 85.933 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0525126223 NA 7.10E-11 mr1907 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525126223 2.92E-06 1.36E-11 mr1934 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525126223 NA 8.71E-10 mr1935 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525126223 NA 1.27E-11 mr1195_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525126223 NA 3.86E-08 mr1567_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525126223 NA 9.97E-06 mr1806_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525126223 1.17E-06 1.48E-12 mr1828_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525126223 NA 3.27E-06 mr1896_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525126223 NA 2.83E-11 mr1907_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525126223 NA 8.74E-10 mr1934_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251