\
| Variant ID: vg0525126223 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 25126223 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 277. )
GAGCACCCGCAATGGTAAAGTAATGTGCTATCTATAAAACATGTACATCTCAGCAATAGACTAGATTAATAGTAAATCACTTCAATGGTATGTCTACATG[G/A]
GTATCTATAGCTCTCTAATTCATTGCCTCGTTTTTCTCTATAGACTATCTCTAAGTTAGTAGATAACTTTGCTCTCTCTCTTCATTTAATCTCTTCCAAG
CTTGGAAGAGATTAAATGAAGAGAGAGAGCAAAGTTATCTACTAACTTAGAGATAGTCTATAGAGAAAAACGAGGCAATGAATTAGAGAGCTATAGATAC[C/T]
CATGTAGACATACCATTGAAGTGATTTACTATTAATCTAGTCTATTGCTGAGATGTACATGTTTTATAGATAGCACATTACTTTACCATTGCGGGTGCTC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 96.80% | 2.90% | 0.28% | 0.00% | NA |
| All Indica | 2759 | 96.10% | 3.70% | 0.18% | 0.00% | NA |
| All Japonica | 1512 | 97.50% | 2.00% | 0.53% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 82.20% | 16.80% | 1.08% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 96.80% | 3.20% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 99.70% | 0.00% | 0.26% | 0.00% | NA |
| Tropical Japonica | 504 | 93.80% | 5.00% | 1.19% | 0.00% | NA |
| Japonica Intermediate | 241 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0525126223 | G -> A | LOC_Os05g43210-LOC_Os05g43220 | intergenic_region ; MODIFIER | silent_mutation | Average:52.042; most accessible tissue: Callus, score: 85.933 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0525126223 | NA | 7.10E-11 | mr1907 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525126223 | 2.92E-06 | 1.36E-11 | mr1934 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525126223 | NA | 8.71E-10 | mr1935 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525126223 | NA | 1.27E-11 | mr1195_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525126223 | NA | 3.86E-08 | mr1567_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525126223 | NA | 9.97E-06 | mr1806_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525126223 | 1.17E-06 | 1.48E-12 | mr1828_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525126223 | NA | 3.27E-06 | mr1896_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525126223 | NA | 2.83E-11 | mr1907_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525126223 | NA | 8.74E-10 | mr1934_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |