\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0524300403:

Variant ID: vg0524300403 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 24300403
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CAGGTACAATAACATGCTATAAGCCAGCTGCAAACATATTTTAAGGAGATAAATCAGGAGAGAGAAGAGCAGCGGGCTACAGATTTATAGCTAGCTGTAG[T/C]
ACGGACTCCAAGACGCAGTGTGTCTATGACAGGTGGGACTAGGTATTAATAGTGTAGCATATAACTATTGTATGAATAAGCTATTAGATTGGCTATAAAT

Reverse complement sequence

ATTTATAGCCAATCTAATAGCTTATTCATACAATAGTTATATGCTACACTATTAATACCTAGTCCCACCTGTCATAGACACACTGCGTCTTGGAGTCCGT[A/G]
CTACAGCTAGCTATAAATCTGTAGCCCGCTGCTCTTCTCTCTCCTGATTTATCTCCTTAAAATATGTTTGCAGCTGGCTTATAGCATGTTATTGTACCTG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 74.40% 24.70% 0.87% 0.00% NA
All Indica  2759 99.20% 0.70% 0.07% 0.00% NA
All Japonica  1512 26.10% 71.40% 2.51% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.80% 0.00% 0.17% 0.00% NA
Indica II  465 97.80% 1.90% 0.22% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 98.70% 1.30% 0.00% 0.00% NA
Temperate Japonica  767 17.90% 77.80% 4.30% 0.00% NA
Tropical Japonica  504 38.70% 60.50% 0.79% 0.00% NA
Japonica Intermediate  241 26.10% 73.40% 0.41% 0.00% NA
VI/Aromatic  96 50.00% 50.00% 0.00% 0.00% NA
Intermediate  90 74.40% 24.40% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0524300403 T -> C LOC_Os05g41510.1 upstream_gene_variant ; 944.0bp to feature; MODIFIER silent_mutation Average:68.383; most accessible tissue: Minghui63 panicle, score: 84.552 N N N N
vg0524300403 T -> C LOC_Os05g41500.1 downstream_gene_variant ; 1404.0bp to feature; MODIFIER silent_mutation Average:68.383; most accessible tissue: Minghui63 panicle, score: 84.552 N N N N
vg0524300403 T -> C LOC_Os05g41500-LOC_Os05g41510 intergenic_region ; MODIFIER silent_mutation Average:68.383; most accessible tissue: Minghui63 panicle, score: 84.552 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0524300403 NA 2.33E-13 mr1035 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524300403 NA 4.21E-06 mr1044 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524300403 NA 6.51E-08 mr1045 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524300403 NA 1.73E-12 mr1069 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524300403 NA 1.71E-07 mr1069 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524300403 NA 8.67E-06 mr1072 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524300403 NA 5.87E-07 mr1075 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524300403 NA 4.80E-14 mr1149 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524300403 NA 9.84E-07 mr1149 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524300403 NA 6.64E-10 mr1162 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524300403 NA 2.44E-07 mr1164 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524300403 NA 4.26E-13 mr1170 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524300403 NA 3.09E-07 mr1183 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524300403 NA 2.05E-07 mr1194 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524300403 NA 1.11E-06 mr1202 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524300403 NA 3.59E-06 mr1291 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524300403 NA 2.16E-07 mr1503 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524300403 NA 1.01E-06 mr1521 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524300403 NA 2.72E-11 mr1626 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524300403 NA 7.69E-11 mr1630 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524300403 NA 3.05E-06 mr1654 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524300403 NA 2.40E-06 mr1654 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524300403 NA 2.38E-09 mr1709 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524300403 1.57E-06 4.55E-10 mr1748 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524300403 NA 1.76E-08 mr1748 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524300403 NA 1.35E-06 mr1761 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524300403 NA 2.16E-06 mr1875 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524300403 NA 7.91E-13 mr1709_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524300403 NA 2.28E-08 mr1748_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251