Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0524300403:

Variant ID: vg0524300403 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 24300403
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CAGGTACAATAACATGCTATAAGCCAGCTGCAAACATATTTTAAGGAGATAAATCAGGAGAGAGAAGAGCAGCGGGCTACAGATTTATAGCTAGCTGTAG[T/C]
ACGGACTCCAAGACGCAGTGTGTCTATGACAGGTGGGACTAGGTATTAATAGTGTAGCATATAACTATTGTATGAATAAGCTATTAGATTGGCTATAAAT

Reverse complement sequence

ATTTATAGCCAATCTAATAGCTTATTCATACAATAGTTATATGCTACACTATTAATACCTAGTCCCACCTGTCATAGACACACTGCGTCTTGGAGTCCGT[A/G]
CTACAGCTAGCTATAAATCTGTAGCCCGCTGCTCTTCTCTCTCCTGATTTATCTCCTTAAAATATGTTTGCAGCTGGCTTATAGCATGTTATTGTACCTG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	74.40%	24.70%	0.87%	0.00%	NA
All Indica	2759	99.20%	0.70%	0.07%	0.00%	NA
All Japonica	1512	26.10%	71.40%	2.51%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	99.80%	0.00%	0.17%	0.00%	NA
Indica II	465	97.80%	1.90%	0.22%	0.00%	NA
Indica III	913	99.90%	0.10%	0.00%	0.00%	NA
Indica Intermediate	786	98.70%	1.30%	0.00%	0.00%	NA
Temperate Japonica	767	17.90%	77.80%	4.30%	0.00%	NA
Tropical Japonica	504	38.70%	60.50%	0.79%	0.00%	NA
Japonica Intermediate	241	26.10%	73.40%	0.41%	0.00%	NA
VI/Aromatic	96	50.00%	50.00%	0.00%	0.00%	NA
Intermediate	90	74.40%	24.40%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0524300403	T -> C	LOC_Os05g41510.1	upstream_gene_variant ; 944.0bp to feature; MODIFIER	silent_mutation	Average:68.383; most accessible tissue: Minghui63 panicle, score: 84.552	N	N	N	N
vg0524300403	T -> C	LOC_Os05g41500.1	downstream_gene_variant ; 1404.0bp to feature; MODIFIER	silent_mutation	Average:68.383; most accessible tissue: Minghui63 panicle, score: 84.552	N	N	N	N
vg0524300403	T -> C	LOC_Os05g41500-LOC_Os05g41510	intergenic_region ; MODIFIER	silent_mutation	Average:68.383; most accessible tissue: Minghui63 panicle, score: 84.552	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0524300403	NA	2.33E-13	mr1035	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524300403	NA	4.21E-06	mr1044	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524300403	NA	6.51E-08	mr1045	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524300403	NA	1.73E-12	mr1069	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524300403	NA	1.71E-07	mr1069	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524300403	NA	8.67E-06	mr1072	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524300403	NA	5.87E-07	mr1075	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524300403	NA	4.80E-14	mr1149	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524300403	NA	9.84E-07	mr1149	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524300403	NA	6.64E-10	mr1162	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524300403	NA	2.44E-07	mr1164	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524300403	NA	4.26E-13	mr1170	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524300403	NA	3.09E-07	mr1183	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524300403	NA	2.05E-07	mr1194	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524300403	NA	1.11E-06	mr1202	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524300403	NA	3.59E-06	mr1291	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524300403	NA	2.16E-07	mr1503	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524300403	NA	1.01E-06	mr1521	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524300403	NA	2.72E-11	mr1626	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524300403	NA	7.69E-11	mr1630	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524300403	NA	3.05E-06	mr1654	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524300403	NA	2.40E-06	mr1654	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524300403	NA	2.38E-09	mr1709	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524300403	1.57E-06	4.55E-10	mr1748	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524300403	NA	1.76E-08	mr1748	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524300403	NA	1.35E-06	mr1761	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524300403	NA	2.16E-06	mr1875	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524300403	NA	7.91E-13	mr1709_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524300403	NA	2.28E-08	mr1748_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251