Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0521525775:

Variant ID: vg0521525775 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 21525775
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.03, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:


CCTCCTCTCCTTCGCCAAGGGCGGGGCGGGCGCCGACGCGCGCGTCGACGCGGTGAGGATCCTGGCCACGGTGGCTCCCGAGCTGGTCCCTTACTTGACC[G/A]
GAGACGGGACGGAGAAGCGCGGGAGGGTCAGGATGGCCGTCGAGGCCTTGGCCGCCGTCTTGTCCGCGGACGGGGTAGGCGAAGACACCAAGGAAGGCCT

Reverse complement sequence

AGGCCTTCCTTGGTGTCTTCGCCTACCCCGTCCGCGGACAAGACGGCGGCCAAGGCCTCGACGGCCATCCTGACCCTCCCGCGCTTCTCCGTCCCGTCTC[C/T]
GGTCAAGTAAGGGACCAGCTCGGGAGCCACCGTGGCCAGGATCCTCACCGCGTCGACGCGCGCGTCGGCGCCCGCCCCGCCCTTGGCGAAGGAGAGGAGG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 60.10% 39.60% 0.25% 0.00% NA
All Indica  2759 37.00% 62.70% 0.36% 0.00% NA
All Japonica  1512 99.10% 0.90% 0.07% 0.00% NA
Aus  269 65.10% 34.90% 0.00% 0.00% NA
Indica I  595 65.20% 34.60% 0.17% 0.00% NA
Indica II  465 26.20% 73.50% 0.22% 0.00% NA
Indica III  913 30.10% 69.60% 0.33% 0.00% NA
Indica Intermediate  786 29.90% 69.50% 0.64% 0.00% NA
Temperate Japonica  767 99.00% 1.00% 0.00% 0.00% NA
Tropical Japonica  504 99.40% 0.60% 0.00% 0.00% NA
Japonica Intermediate  241 98.80% 0.80% 0.41% 0.00% NA
VI/Aromatic  96 96.90% 3.10% 0.00% 0.00% NA
Intermediate  90 62.20% 36.70% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0521525775 G -> A LOC_Os05g36360.1 missense_variant ; p.Gly190Arg; MODERATE nonsynonymous_codon ; G190R Average:94.336; most accessible tissue: Zhenshan97 flag leaf, score: 98.188 benign 0.707 TOLERATED 0.56

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0521525775 G A -0.01 -0.01 -0.01 -0.01 0.0 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0521525775 NA 3.06E-09 mr1174 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251