Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0521525472:

Variant ID: vg0521525472 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 21525472
Reference Allele: CAlternative Allele: A
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.88, A: 0.12, others allele: 0.00, population size: 84. )

Flanking Sequence (100 bp) in Reference Genome:


GGCGTCCATACAGCGGTGGCTCGATACCGGCCACCGCACCTGCCCGGCCACGCGGCTCCCGCTGGCGTCCACCGACCTCGTCCCCAACCTGCTCCTGCGC[C/A]
GGCTCATACACCTGCACGCCGCCACGCTGCCGCCCTCGCCCTCCCCGGAGGTGGTGCTCTCGCAGCTCGCGGCGGCGGGCGGGGAGCCCGCCGCGGCGGA

Reverse complement sequence

TCCGCCGCGGCGGGCTCCCCGCCCGCCGCCGCGAGCTGCGAGAGCACCACCTCCGGGGAGGGCGAGGGCGGCAGCGTGGCGGCGTGCAGGTGTATGAGCC[G/T]
GCGCAGGAGCAGGTTGGGGACGAGGTCGGTGGACGCCAGCGGGAGCCGCGTGGCCGGGCAGGTGCGGTGGCCGGTATCGAGCCACCGCTGTATGGACGCC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.90% 30.90% 5.27% 0.89% NA
All Indica  2759 96.70% 2.00% 0.87% 0.47% NA
All Japonica  1512 1.10% 82.70% 14.29% 1.92% NA
Aus  269 90.00% 8.20% 1.86% 0.00% NA
Indica I  595 99.50% 0.20% 0.34% 0.00% NA
Indica II  465 92.70% 3.00% 2.80% 1.51% NA
Indica III  913 98.70% 1.20% 0.00% 0.11% NA
Indica Intermediate  786 94.70% 3.60% 1.15% 0.64% NA
Temperate Japonica  767 1.20% 71.40% 23.73% 3.65% NA
Tropical Japonica  504 1.00% 97.60% 1.39% 0.00% NA
Japonica Intermediate  241 0.80% 87.60% 11.20% 0.41% NA
VI/Aromatic  96 3.10% 96.90% 0.00% 0.00% NA
Intermediate  90 48.90% 46.70% 4.44% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0521525472 C -> DEL LOC_Os05g36360.1 N frameshift_variant Average:97.525; most accessible tissue: Zhenshan97 flag leaf, score: 99.334 N N N N
vg0521525472 C -> A LOC_Os05g36360.1 synonymous_variant ; p.Arg89Arg; LOW synonymous_codon Average:97.525; most accessible tissue: Zhenshan97 flag leaf, score: 99.334 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0521525472 C A 0.02 0.02 0.02 0.02 0.02 0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0521525472 NA 1.63E-71 mr1027 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521525472 NA 7.05E-14 mr1218 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521525472 NA 6.42E-88 mr1517 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521525472 NA 5.91E-37 mr1542 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521525472 NA 2.72E-08 mr1595 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521525472 NA 4.11E-82 mr1672 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521525472 NA 2.33E-80 mr1718 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521525472 NA 8.53E-88 mr1758 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521525472 NA 8.80E-54 mr1795 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521525472 NA 1.38E-22 mr1888 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521525472 NA 2.33E-38 mr1890 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521525472 NA 4.78E-60 mr1962 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521525472 NA 6.05E-58 mr1064_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521525472 NA 3.43E-71 mr1087_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521525472 NA 4.76E-54 mr1124_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521525472 NA 3.09E-94 mr1536_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521525472 NA 5.16E-10 mr1595_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521525472 NA 5.23E-22 mr1609_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521525472 NA 1.72E-38 mr1689_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521525472 NA 4.95E-108 mr1718_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521525472 NA 1.50E-89 mr1795_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521525472 NA 4.16E-39 mr1888_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251