Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0520358656:

Variant ID: vg0520358656 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 20358656
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, T: 0.01, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:

CGCGTTAGCAAACTATTTGCCGACGGCGTTGAAAGGTTCTGCGCGTTCGTGGCTGATGCACCTCCCGCCCTACTCGATTTCTTCATGGGCAGATCTGTGG[C/T]
AGCAATTCATCACCAACTTCCAAGGAACTTACAAGCGCCACGCGATCGAAGACGATCTACACGCGTTAACACAGAATCCGGGCGAATCTTTGAGGGACTA

Reverse complement sequence

TAGTCCCTCAAAGATTCGCCCGGATTCTGTGTTAACGCGTGTAGATCGTCTTCGATCGCGTGGCGCTTGTAAGTTCCTTGGAAGTTGGTGATGAATTGCT[G/A]
CCACAGATCTGCCCATGAAGAAATCGAGTAGGGCGGGAGGTGCATCAGCCACGAACGCGCAGAACCTTTCAACGCCGTCGGCAAATAGTTTGCTAACGCG

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	58.50%	41.40%	0.13%	0.00%	NA
All Indica	2759	96.10%	3.70%	0.18%	0.00%	NA
All Japonica	1512	2.70%	97.30%	0.00%	0.00%	NA
Aus	269	8.90%	91.10%	0.00%	0.00%	NA
Indica I	595	99.20%	0.80%	0.00%	0.00%	NA
Indica II	465	96.80%	3.20%	0.00%	0.00%	NA
Indica III	913	97.40%	2.20%	0.44%	0.00%	NA
Indica Intermediate	786	92.00%	7.90%	0.13%	0.00%	NA
Temperate Japonica	767	3.80%	96.20%	0.00%	0.00%	NA
Tropical Japonica	504	2.00%	98.00%	0.00%	0.00%	NA
Japonica Intermediate	241	0.80%	99.20%	0.00%	0.00%	NA
VI/Aromatic	96	2.10%	97.90%	0.00%	0.00%	NA
Intermediate	90	50.00%	48.90%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0520358656	C -> T	LOC_Os05g34340.1	upstream_gene_variant ; 3206.0bp to feature; MODIFIER	silent_mutation	Average:24.862; most accessible tissue: Minghui63 young leaf, score: 31.294	N	N	N	N
vg0520358656	C -> T	LOC_Os05g34350.1	intron_variant ; MODIFIER	silent_mutation	Average:24.862; most accessible tissue: Minghui63 young leaf, score: 31.294	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0520358656	NA	7.59E-07	Awn_length	Ind_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0520358656	5.44E-07	NA	mr1043	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520358656	2.66E-06	NA	mr1043	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520358656	NA	1.86E-52	mr1109	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520358656	NA	7.90E-48	mr1125	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520358656	NA	3.24E-36	mr1129	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520358656	NA	9.50E-29	mr1181	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520358656	NA	1.11E-14	mr1199	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520358656	NA	1.14E-30	mr1208	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520358656	NA	9.00E-32	mr1224	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520358656	NA	3.53E-20	mr1244	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520358656	NA	1.46E-17	mr1255	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520358656	NA	9.01E-31	mr1257	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520358656	NA	5.45E-15	mr1261	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520358656	NA	2.11E-13	mr1270	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520358656	NA	5.22E-11	mr1299	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520358656	NA	7.32E-08	mr1321	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520358656	NA	3.77E-28	mr1426	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520358656	NA	1.70E-29	mr1436	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520358656	NA	2.37E-41	mr1458	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520358656	9.23E-06	NA	mr1535	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520358656	4.27E-07	NA	mr1535	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520358656	NA	1.36E-26	mr1537	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520358656	NA	2.52E-28	mr1551	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520358656	NA	5.88E-20	mr1552	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520358656	NA	6.25E-10	mr1581	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520358656	6.17E-06	NA	mr1675	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520358656	NA	6.15E-17	mr1700	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520358656	NA	1.38E-11	mr1720	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520358656	NA	2.12E-31	mr1745	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520358656	NA	8.83E-09	mr1756	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520358656	NA	1.44E-07	mr1804	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520358656	NA	1.86E-11	mr1883	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520358656	4.83E-08	NA	mr1912	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520358656	2.69E-06	3.80E-06	mr1912	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520358656	NA	5.87E-18	mr1916	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520358656	NA	5.86E-45	mr1094_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520358656	NA	1.26E-57	mr1109_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520358656	NA	1.41E-37	mr1110_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520358656	NA	5.84E-35	mr1181_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520358656	NA	9.14E-38	mr1208_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520358656	NA	2.28E-36	mr1224_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520358656	NA	4.23E-25	mr1244_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520358656	NA	6.58E-48	mr1458_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520358656	NA	3.50E-23	mr1551_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520358656	NA	8.45E-10	mr1649_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520358656	NA	1.11E-15	mr1720_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520358656	NA	2.27E-38	mr1745_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251