Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0520266468:

Variant ID: vg0520266468 (JBrowse)	Variation Type: INDEL
Chromosome: chr05	Position: 20266468
Reference Allele: CACA	Alternative Allele: C
Primary Allele: CACA	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GGCTAGGGTTAGCTTGGCGCGGCGGCGGTTGTTGCTTGTGCCGACGAGCAATTGGGGGCGTCGTCGTCGTCGATTTGGGGGAAATTTGGGTGGGGCGGTT[CACA/C]
ACTTCACATTACGAGGACCAGCTGACCAAGTCGTCGTTTTTGCTTGGTGCTAGGATTAGCTGACCGGGTCAAAGTCCAAGCTCCCGCGTTCAAAGAGGGC

Reverse complement sequence

GCCCTCTTTGAACGCGGGAGCTTGGACTTTGACCCGGTCAGCTAATCCTAGCACCAAGCAAAAACGACGACTTGGTCAGCTGGTCCTCGTAATGTGAAGT[TGTG/G]
AACCGCCCCACCCAAATTTCCCCCAAATCGACGACGACGACGCCCCCAATTGCTCGTCGGCACAAGCAACAACCGCCGCCGCGCCAAGCTAACCCTAGCC

Allele Frequencies:

Populations	Population Size	Frequency of CACA(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	66.20%	18.00%	10.81%	4.99%	NA
All Indica	2759	71.30%	2.60%	18.16%	8.01%	NA
All Japonica	1512	64.90%	34.10%	0.33%	0.60%	NA
Aus	269	10.00%	89.60%	0.37%	0.00%	NA
Indica I	595	65.20%	0.30%	28.74%	5.71%	NA
Indica II	465	60.40%	1.70%	24.30%	13.55%	NA
Indica III	913	85.90%	1.30%	7.12%	5.70%	NA
Indica Intermediate	786	65.30%	6.20%	19.34%	9.16%	NA
Temperate Japonica	767	96.90%	1.60%	0.52%	1.04%	NA
Tropical Japonica	504	9.10%	90.70%	0.00%	0.20%	NA
Japonica Intermediate	241	80.10%	19.50%	0.41%	0.00%	NA
VI/Aromatic	96	97.90%	2.10%	0.00%	0.00%	NA
Intermediate	90	65.60%	23.30%	4.44%	6.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0520266468	CACA -> DEL	N	N	silent_mutation	Average:97.987; most accessible tissue: Zhenshan97 flag leaf, score: 99.455	N	N	N	N
vg0520266468	CACA -> C	LOC_Os05g34230.1	5_prime_UTR_variant ; 108.0bp to feature; MODIFIER	silent_mutation	Average:97.987; most accessible tissue: Zhenshan97 flag leaf, score: 99.455	N	N	N	N
vg0520266468	CACA -> C	LOC_Os05g34220.1	downstream_gene_variant ; 4290.0bp to feature; MODIFIER	silent_mutation	Average:97.987; most accessible tissue: Zhenshan97 flag leaf, score: 99.455	N	N	N	N
vg0520266468	CACA -> C	LOC_Os05g34240.1	downstream_gene_variant ; 1230.0bp to feature; MODIFIER	silent_mutation	Average:97.987; most accessible tissue: Zhenshan97 flag leaf, score: 99.455	N	N	N	N
vg0520266468	CACA -> C	LOC_Os05g34220.2	downstream_gene_variant ; 3995.0bp to feature; MODIFIER	silent_mutation	Average:97.987; most accessible tissue: Zhenshan97 flag leaf, score: 99.455	N	N	N	N
vg0520266468	CACA -> C	LOC_Os05g34240.2	downstream_gene_variant ; 1230.0bp to feature; MODIFIER	silent_mutation	Average:97.987; most accessible tissue: Zhenshan97 flag leaf, score: 99.455	N	N	N	N
vg0520266468	CACA -> C	LOC_Os05g34240.3	downstream_gene_variant ; 1230.0bp to feature; MODIFIER	silent_mutation	Average:97.987; most accessible tissue: Zhenshan97 flag leaf, score: 99.455	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0520266468	CACA	C	-0.01	0.05	0.09	0.04	0.07	0.07