\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0519461555:

Variant ID: vg0519461555 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 19461555
Reference Allele: AAlternative Allele: T
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.69, A: 0.31, others allele: 0.00, population size: 51. )

Flanking Sequence (100 bp) in Reference Genome:


GGCACGCTTAGAGGTCATTAATAGGGCTTAATTTTCACTGTTTGTTGAGTTGTCCCGTTTCGCGTGTAGTTTCGGAGCCCGAAGACCCGTAGTGCGAGGA[A/T]
TTCGAGGATCAAGCTCAAGATCTCGAGCAAGGCAAGCCACCTTTGAACATATTGAGCCTATATTTGAACTTAATTATATTGCTTGCAAAATATCATGCAT

Reverse complement sequence

ATGCATGATATTTTGCAAGCAATATAATTAAGTTCAAATATAGGCTCAATATGTTCAAAGGTGGCTTGCCTTGCTCGAGATCTTGAGCTTGATCCTCGAA[T/A]
TCCTCGCACTACGGGTCTTCGGGCTCCGAAACTACACGCGAAACGGGACAACTCAACAAACAGTGAAAATTAAGCCCTATTAATGACCTCTAAGCGTGCC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 33.40% 22.70% 32.12% 11.85% NA
All Indica  2759 51.40% 2.00% 39.14% 7.50% NA
All Japonica  1512 3.60% 63.60% 13.10% 19.71% NA
Aus  269 27.90% 11.50% 60.22% 0.37% NA
Indica I  595 53.30% 0.50% 36.30% 9.92% NA
Indica II  465 35.70% 1.70% 50.54% 12.04% NA
Indica III  913 61.10% 1.60% 33.19% 4.05% NA
Indica Intermediate  786 48.00% 3.60% 41.48% 7.00% NA
Temperate Japonica  767 1.00% 94.40% 2.22% 2.35% NA
Tropical Japonica  504 9.10% 10.10% 32.54% 48.21% NA
Japonica Intermediate  241 0.00% 77.60% 7.05% 15.35% NA
VI/Aromatic  96 7.30% 4.20% 43.75% 44.79% NA
Intermediate  90 25.60% 22.20% 40.00% 12.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0519461555 A -> T LOC_Os05g33180.1 upstream_gene_variant ; 4648.0bp to feature; MODIFIER silent_mutation Average:8.965; most accessible tissue: Callus, score: 31.665 N N N N
vg0519461555 A -> T LOC_Os05g33190.1 upstream_gene_variant ; 3578.0bp to feature; MODIFIER silent_mutation Average:8.965; most accessible tissue: Callus, score: 31.665 N N N N
vg0519461555 A -> T LOC_Os05g33180-LOC_Os05g33190 intergenic_region ; MODIFIER silent_mutation Average:8.965; most accessible tissue: Callus, score: 31.665 N N N N
vg0519461555 A -> DEL N N silent_mutation Average:8.965; most accessible tissue: Callus, score: 31.665 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0519461555 NA 1.39E-08 mr1422 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519461555 NA 1.13E-07 mr1443 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519461555 NA 5.27E-07 mr1679_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519461555 NA 2.64E-07 mr1733_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519461555 2.79E-08 NA mr1745_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519461555 1.12E-06 NA mr1745_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251