Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0519167492:

Variant ID: vg0519167492 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 19167492
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.93, A: 0.07, others allele: 0.00, population size: 295. )

Flanking Sequence (100 bp) in Reference Genome:


TATATGTGATTACATCTGGTGTCCACCCTTTTGCAGTGCTCTCCTCAAGAAGGGCATCTACCTCCTCGAAAGCCCCAACCTTGCAGAGAGCTTCAACCAA[G/A]
ACATTGTAAGTGGCTGTACTTGGAGCAAATCCACTGGCAATCATAGTGTTCAACAGCCTCTTCGCCTCATGTATCCTCCCACCCGTGCAATATGCGTGCA

Reverse complement sequence

TGCACGCATATTGCACGGGTGGGAGGATACATGAGGCGAAGAGGCTGTTGAACACTATGATTGCCAGTGGATTTGCTCCAAGTACAGCCACTTACAATGT[C/T]
TTGGTTGAAGCTCTCTGCAAGGTTGGGGCTTTCGAGGAGGTAGATGCCCTTCTTGAGGAGAGCACTGCAAAAGGGTGGACACCAGATGTAATCACATATA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 63.90% 35.40% 0.02% 0.66% NA
All Indica  2759 54.40% 44.60% 0.04% 0.98% NA
All Japonica  1512 87.60% 12.30% 0.00% 0.07% NA
Aus  269 15.20% 84.80% 0.00% 0.00% NA
Indica I  595 28.10% 71.10% 0.17% 0.67% NA
Indica II  465 58.50% 40.20% 0.00% 1.29% NA
Indica III  913 61.10% 38.00% 0.00% 0.88% NA
Indica Intermediate  786 64.00% 34.90% 0.00% 1.15% NA
Temperate Japonica  767 98.70% 1.30% 0.00% 0.00% NA
Tropical Japonica  504 71.20% 28.60% 0.00% 0.20% NA
Japonica Intermediate  241 86.70% 13.30% 0.00% 0.00% NA
VI/Aromatic  96 92.70% 7.30% 0.00% 0.00% NA
Intermediate  90 74.40% 22.20% 0.00% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0519167492 G -> DEL LOC_Os05g32730.1 N frameshift_variant Average:88.48; most accessible tissue: Minghui63 flag leaf, score: 93.714 N N N N
vg0519167492 G -> A LOC_Os05g32730.1 synonymous_variant ; p.Val248Val; LOW synonymous_codon Average:88.48; most accessible tissue: Minghui63 flag leaf, score: 93.714 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0519167492 G A 0.0 0.0 0.01 -0.01 0.0 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0519167492 NA 1.99E-07 mr1039 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519167492 NA 1.26E-06 mr1044 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519167492 NA 1.57E-06 mr1044 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519167492 NA 2.07E-06 mr1199 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519167492 NA 2.63E-14 mr1301 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519167492 NA 2.80E-11 mr1410 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519167492 NA 4.26E-06 mr1482 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519167492 NA 6.60E-06 mr1482 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519167492 NA 2.35E-06 mr1518 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519167492 NA 9.03E-06 mr1525 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519167492 NA 2.51E-09 mr1676 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519167492 NA 1.40E-13 mr1769 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519167492 NA 2.46E-07 mr1830 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519167492 NA 2.04E-08 mr1951 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519167492 NA 5.92E-06 mr1131_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519167492 NA 1.65E-06 mr1199_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519167492 NA 1.79E-06 mr1325_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519167492 NA 7.07E-06 mr1333_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519167492 NA 1.84E-11 mr1410_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519167492 NA 1.65E-08 mr1482_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519167492 NA 6.45E-06 mr1482_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519167492 NA 1.04E-06 mr1498_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519167492 NA 4.84E-09 mr1676_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519167492 NA 8.52E-06 mr1763_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519167492 NA 6.87E-15 mr1769_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251