Variant ID: vg0519167025 (JBrowse) | Variation Type: SNP |
Chromosome: chr05 | Position: 19167025 |
Reference Allele: A | Alternative Allele: C |
Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 340. )
TAAGAGGCAAACTTCATTGCCTTCCCCAGAAATACTGAGATGACGGATTAAAGTATTGTATGTGATAACGGTAGCTACAAACTCTTTGCTTCTCAGCAGA[A/C]
AAAGCGCTTTATGAAGTCTCCCCAATTTACAGAGGCTGTGGACAACAATGTTGAAGGTCCAGCTATTTGGAGCAATGCCTTTCTTGGCCATGTCAGTGAA
TTCACTGACATGGCCAAGAAAGGCATTGCTCCAAATAGCTGGACCTTCAACATTGTTGTCCACAGCCTCTGTAAATTGGGGAGACTTCATAAAGCGCTTT[T/G]
TCTGCTGAGAAGCAAAGAGTTTGTAGCTACCGTTATCACATACAATACTTTAATCCGTCATCTCAGTATTTCTGGGGAAGGCAATGAAGTTTGCCTCTTA
Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 69.90% | 30.00% | 0.02% | 0.06% | NA |
All Indica | 2759 | 99.20% | 0.80% | 0.00% | 0.04% | NA |
All Japonica | 1512 | 15.30% | 84.60% | 0.00% | 0.07% | NA |
Aus | 269 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
Indica I | 595 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
Indica II | 465 | 99.10% | 0.90% | 0.00% | 0.00% | NA |
Indica III | 913 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
Indica Intermediate | 786 | 98.70% | 1.10% | 0.00% | 0.13% | NA |
Temperate Japonica | 767 | 5.20% | 94.80% | 0.00% | 0.00% | NA |
Tropical Japonica | 504 | 31.20% | 68.70% | 0.00% | 0.20% | NA |
Japonica Intermediate | 241 | 14.50% | 85.50% | 0.00% | 0.00% | NA |
VI/Aromatic | 96 | 8.30% | 91.70% | 0.00% | 0.00% | NA |
Intermediate | 90 | 67.80% | 30.00% | 1.11% | 1.11% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0519167025 | A -> DEL | LOC_Os05g32730.1 | N | frameshift_variant | Average:59.539; most accessible tissue: Callus, score: 81.032 | N | N | N | N |
vg0519167025 | A -> C | LOC_Os05g32730.1 | missense_variant ; p.Phe404Cys; MODERATE | nonsynonymous_codon ; F404C | Average:59.539; most accessible tissue: Callus, score: 81.032 | unknown | unknown | TOLERATED | 1.00 |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0519167025 | NA | 1.35E-09 | mr1277 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0519167025 | 9.66E-06 | NA | mr1301 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0519167025 | 3.75E-07 | NA | mr1410 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0519167025 | NA | 1.49E-07 | mr1676 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0519167025 | NA | 7.45E-33 | mr1733 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0519167025 | 3.17E-07 | NA | mr1410_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0519167025 | NA | 1.03E-06 | mr1629_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0519167025 | NA | 2.38E-07 | mr1676_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |