Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0517886449:

Variant ID: vg0517886449 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 17886449
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.03, others allele: 0.00, population size: 232. )

Flanking Sequence (100 bp) in Reference Genome:


TAATAAAGTTATAACCACGGGGGCCTCCTCTGCTGTAGGTTTGATCCACACACATACACGAAAAAAAAAAACCTGGCCCACTGCCTAACAGACAAACAGT[A/G]
GCATTTACCAAACATCCATAGTTACCACTTTTTTGTTGATGTGGACATAAACAAGCTATGACAGATTATATTGGACCAATAAATAAAAAGTTATGTTCTT

Reverse complement sequence

AAGAACATAACTTTTTATTTATTGGTCCAATATAATCTGTCATAGCTTGTTTATGTCCACATCAACAAAAAAGTGGTAACTATGGATGTTTGGTAAATGC[T/C]
ACTGTTTGTCTGTTAGGCAGTGGGCCAGGTTTTTTTTTTTCGTGTATGTGTGTGGATCAAACCTACAGCAGAGGAGGCCCCCGTGGTTATAACTTTATTA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 64.70% 34.90% 0.40% 0.04% NA
All Indica  2759 94.10% 5.50% 0.40% 0.04% NA
All Japonica  1512 8.70% 91.00% 0.26% 0.07% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 99.80% 0.00% 0.17% 0.00% NA
Indica II  465 74.40% 24.50% 1.08% 0.00% NA
Indica III  913 99.00% 0.50% 0.44% 0.00% NA
Indica Intermediate  786 95.70% 4.10% 0.13% 0.13% NA
Temperate Japonica  767 3.00% 97.00% 0.00% 0.00% NA
Tropical Japonica  504 20.00% 79.60% 0.20% 0.20% NA
Japonica Intermediate  241 2.90% 95.90% 1.24% 0.00% NA
VI/Aromatic  96 12.50% 87.50% 0.00% 0.00% NA
Intermediate  90 55.60% 40.00% 4.44% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0517886449 A -> DEL N N silent_mutation Average:74.279; most accessible tissue: Minghui63 flower, score: 89.149 N N N N
vg0517886449 A -> G LOC_Os05g30810.1 upstream_gene_variant ; 4201.0bp to feature; MODIFIER silent_mutation Average:74.279; most accessible tissue: Minghui63 flower, score: 89.149 N N N N
vg0517886449 A -> G LOC_Os05g30810.2 upstream_gene_variant ; 4201.0bp to feature; MODIFIER silent_mutation Average:74.279; most accessible tissue: Minghui63 flower, score: 89.149 N N N N
vg0517886449 A -> G LOC_Os05g30820.2 downstream_gene_variant ; 49.0bp to feature; MODIFIER silent_mutation Average:74.279; most accessible tissue: Minghui63 flower, score: 89.149 N N N N
vg0517886449 A -> G LOC_Os05g30820.1 intron_variant ; MODIFIER silent_mutation Average:74.279; most accessible tissue: Minghui63 flower, score: 89.149 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0517886449 A G -0.05 -0.01 0.0 -0.01 -0.03 -0.04

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0517886449 NA 2.70E-06 mr1044 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517886449 NA 7.42E-12 mr1069 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517886449 NA 1.88E-28 mr1075 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517886449 NA 1.12E-18 mr1133 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517886449 NA 1.05E-29 mr1202 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517886449 NA 9.97E-17 mr1842 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517886449 NA 3.51E-12 mr1902 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517886449 NA 2.47E-38 mr1072_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517886449 NA 1.58E-07 mr1654_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251