Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0517885764:

Variant ID: vg0517885764 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 17885764
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.75, A: 0.25, others allele: 0.00, population size: 281. )

Flanking Sequence (100 bp) in Reference Genome:

AGAAAGATACATACAGCTCTGTTTCTTCTCACCTTTCCCTACCAAATTATACCAACCATGATAAGCCTAAAAAAAATCATACATGGCATATCACAACAAT[G/A]
CAGAGCCTGTACAACTTCTAAGAAACAACAGCTGTTAGACTCTACAGACAATCATCATGTCATCAAATAGCAGACATGCAATCAATTTTCATCTTCGCTA

Reverse complement sequence

TAGCGAAGATGAAAATTGATTGCATGTCTGCTATTTGATGACATGATGATTGTCTGTAGAGTCTAACAGCTGTTGTTTCTTAGAAGTTGTACAGGCTCTG[C/T]
ATTGTTGTGATATGCCATGTATGATTTTTTTTAGGCTTATCATGGTTGGTATAATTTGGTAGGGAAAGGTGAGAAGAAACAGAGCTGTATGTATCTTTCT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	64.50%	35.10%	0.04%	0.40%	NA
All Indica	2759	94.00%	5.50%	0.04%	0.43%	NA
All Japonica	1512	8.50%	91.10%	0.07%	0.33%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	99.80%	0.00%	0.00%	0.17%	NA
Indica II	465	74.40%	24.50%	0.00%	1.08%	NA
Indica III	913	99.00%	0.50%	0.00%	0.44%	NA
Indica Intermediate	786	95.40%	4.20%	0.13%	0.25%	NA
Temperate Japonica	767	3.00%	97.00%	0.00%	0.00%	NA
Tropical Japonica	504	19.80%	79.60%	0.20%	0.40%	NA
Japonica Intermediate	241	2.50%	96.30%	0.00%	1.24%	NA
VI/Aromatic	96	7.30%	92.70%	0.00%	0.00%	NA
Intermediate	90	54.40%	43.30%	0.00%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0517885764	G -> DEL	N	N	silent_mutation	Average:61.196; most accessible tissue: Callus, score: 82.543	N	N	N	N
vg0517885764	G -> A	LOC_Os05g30820.1	3_prime_UTR_variant ; 98.0bp to feature; MODIFIER	silent_mutation	Average:61.196; most accessible tissue: Callus, score: 82.543	N	N	N	N
vg0517885764	G -> A	LOC_Os05g30810.1	upstream_gene_variant ; 3516.0bp to feature; MODIFIER	silent_mutation	Average:61.196; most accessible tissue: Callus, score: 82.543	N	N	N	N
vg0517885764	G -> A	LOC_Os05g30810.2	upstream_gene_variant ; 3516.0bp to feature; MODIFIER	silent_mutation	Average:61.196; most accessible tissue: Callus, score: 82.543	N	N	N	N
vg0517885764	G -> A	LOC_Os05g30820.2	downstream_gene_variant ; 734.0bp to feature; MODIFIER	silent_mutation	Average:61.196; most accessible tissue: Callus, score: 82.543	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0517885764	NA	2.53E-06	mr1044	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517885764	NA	2.70E-06	mr1044	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517885764	NA	8.05E-12	mr1069	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517885764	NA	1.86E-18	mr1133	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517885764	NA	1.57E-29	mr1202	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517885764	NA	2.33E-17	mr1842	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517885764	NA	1.46E-12	mr1902	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517885764	NA	4.07E-38	mr1072_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517885764	NA	3.56E-07	mr1654_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251