Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0517221319:

Variant ID: vg0517221319 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 17221319
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, C: 0.01, others allele: 0.00, population size: 84. )

Flanking Sequence (100 bp) in Reference Genome:

AATCTCCCAACCCGGAAATGCTAATGGGTGATTGATCGCCTGGCGATGGGGGTAGCGATCAATTCGCCCCCCCTCCCTATCCCTCCACCTGGTTTCCTTT[T/C]
TTTTGGCACCGCATTACTTTCCTATTTTAGTAAATTTATGCACCTAAAGTTTATACACCTCAATTTTACACATCTAAAGTTTAGAGACCCAAAGTTTATA

Reverse complement sequence

TATAAACTTTGGGTCTCTAAACTTTAGATGTGTAAAATTGAGGTGTATAAACTTTAGGTGCATAAATTTACTAAAATAGGAAAGTAATGCGGTGCCAAAA[A/G]
AAAGGAAACCAGGTGGAGGGATAGGGAGGGGGGGCGAATTGATCGCTACCCCCATCGCCAGGCGATCAATCACCCATTAGCATTTCCGGGTTGGGAGATT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	50.70%	49.00%	0.28%	0.00%	NA
All Indica	2759	78.40%	21.20%	0.36%	0.00%	NA
All Japonica	1512	9.40%	90.60%	0.00%	0.00%	NA
Aus	269	19.30%	80.30%	0.37%	0.00%	NA
Indica I	595	71.80%	27.70%	0.50%	0.00%	NA
Indica II	465	74.00%	25.80%	0.22%	0.00%	NA
Indica III	913	82.40%	17.50%	0.11%	0.00%	NA
Indica Intermediate	786	81.40%	17.90%	0.64%	0.00%	NA
Temperate Japonica	767	3.00%	97.00%	0.00%	0.00%	NA
Tropical Japonica	504	21.20%	78.80%	0.00%	0.00%	NA
Japonica Intermediate	241	5.00%	95.00%	0.00%	0.00%	NA
VI/Aromatic	96	0.00%	100.00%	0.00%	0.00%	NA
Intermediate	90	43.30%	54.40%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0517221319	T -> C	LOC_Os05g29770.1	upstream_gene_variant ; 1117.0bp to feature; MODIFIER	silent_mutation	Average:38.518; most accessible tissue: Callus, score: 47.927	N	N	N	N
vg0517221319	T -> C	LOC_Os05g29760.1	downstream_gene_variant ; 4836.0bp to feature; MODIFIER	silent_mutation	Average:38.518; most accessible tissue: Callus, score: 47.927	N	N	N	N
vg0517221319	T -> C	LOC_Os05g29760.3	downstream_gene_variant ; 4836.0bp to feature; MODIFIER	silent_mutation	Average:38.518; most accessible tissue: Callus, score: 47.927	N	N	N	N
vg0517221319	T -> C	LOC_Os05g29760.4	downstream_gene_variant ; 4836.0bp to feature; MODIFIER	silent_mutation	Average:38.518; most accessible tissue: Callus, score: 47.927	N	N	N	N
vg0517221319	T -> C	LOC_Os05g29760.2	downstream_gene_variant ; 4543.0bp to feature; MODIFIER	silent_mutation	Average:38.518; most accessible tissue: Callus, score: 47.927	N	N	N	N
vg0517221319	T -> C	LOC_Os05g29760.5	downstream_gene_variant ; 4836.0bp to feature; MODIFIER	silent_mutation	Average:38.518; most accessible tissue: Callus, score: 47.927	N	N	N	N
vg0517221319	T -> C	LOC_Os05g29770-LOC_Os05g29780	intergenic_region ; MODIFIER	silent_mutation	Average:38.518; most accessible tissue: Callus, score: 47.927	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0517221319	NA	8.12E-06	mr1580	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517221319	NA	1.69E-11	mr1446_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517221319	NA	6.22E-06	mr1446_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517221319	NA	1.53E-07	mr1875_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517221319	NA	1.93E-06	mr1908_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251