\
| Variant ID: vg0515924941 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 15924941 |
| Reference Allele: G | Alternative Allele: T |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, T: 0.01, others allele: 0.00, population size: 99. )
CCTGGTGCGCGCCGCATAGCCCCTGGTGTATCTCCTTTGCCATTTCTTCGCCTTCGGCAAATGAGATACAACGAAGTAAGGGTTGAAGTACCCCAGTGCG[G/T]
TAAAGCTAACCCGAAACCATCTTATATTTCGTGGCTCTGAGCTGCAAACGCTTCGCTTCTGTTTCGTCTACCGGAAGCCAGCCTGTTTCAAGGTGTTTCA
TGAAACACCTTGAAACAGGCTGGCTTCCGGTAGACGAAACAGAAGCGAAGCGTTTGCAGCTCAGAGCCACGAAATATAAGATGGTTTCGGGTTAGCTTTA[C/A]
CGCACTGGGGTACTTCAACCCTTACTTCGTTGTATCTCATTTGCCGAAGGCGAAGAAATGGCAAAGGAGATACACCAGGGGCTATGCGGCGCGCACCAGG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 37.50% | 7.60% | 22.75% | 32.10% | NA |
| All Indica | 2759 | 17.40% | 10.30% | 31.53% | 40.78% | NA |
| All Japonica | 1512 | 76.00% | 1.10% | 1.32% | 21.56% | NA |
| Aus | 269 | 1.50% | 20.10% | 61.34% | 17.10% | NA |
| Indica I | 595 | 9.60% | 4.40% | 23.53% | 62.52% | NA |
| Indica II | 465 | 28.40% | 4.10% | 40.86% | 26.67% | NA |
| Indica III | 913 | 22.10% | 16.10% | 24.86% | 36.91% | NA |
| Indica Intermediate | 786 | 11.20% | 11.80% | 39.82% | 37.15% | NA |
| Temperate Japonica | 767 | 93.40% | 0.00% | 0.39% | 6.26% | NA |
| Tropical Japonica | 504 | 47.40% | 3.00% | 2.58% | 47.02% | NA |
| Japonica Intermediate | 241 | 80.50% | 0.80% | 1.66% | 17.01% | NA |
| VI/Aromatic | 96 | 99.00% | 0.00% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 52.20% | 4.40% | 21.11% | 22.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0515924941 | G -> T | LOC_Os05g27380.1 | upstream_gene_variant ; 4499.0bp to feature; MODIFIER | silent_mutation | Average:15.925; most accessible tissue: Zhenshan97 root, score: 27.411 | N | N | N | N |
| vg0515924941 | G -> T | LOC_Os05g27390.1 | downstream_gene_variant ; 2396.0bp to feature; MODIFIER | silent_mutation | Average:15.925; most accessible tissue: Zhenshan97 root, score: 27.411 | N | N | N | N |
| vg0515924941 | G -> T | LOC_Os05g27400.1 | intron_variant ; MODIFIER | silent_mutation | Average:15.925; most accessible tissue: Zhenshan97 root, score: 27.411 | N | N | N | N |
| vg0515924941 | G -> DEL | N | N | silent_mutation | Average:15.925; most accessible tissue: Zhenshan97 root, score: 27.411 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0515924941 | NA | 5.66E-13 | Grain_thickness | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0515924941 | NA | 2.80E-17 | Grain_width | Jap_All | YES | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0515924941 | NA | 8.17E-14 | mr1301 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0515924941 | NA | 1.30E-13 | mr1410 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0515924941 | NA | 1.73E-14 | mr1771 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0515924941 | NA | 6.17E-12 | mr1784 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0515924941 | NA | 9.34E-08 | mr1862 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0515924941 | NA | 1.18E-07 | mr1993 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0515924941 | NA | 1.16E-15 | mr1301_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0515924941 | NA | 7.58E-14 | mr1410_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0515924941 | NA | 4.76E-17 | mr1539_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |