\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0515177250:

Variant ID: vg0515177250 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 15177250
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.94, T: 0.06, others allele: 0.00, population size: 81. )

Flanking Sequence (100 bp) in Reference Genome:


ACTAACGGACACAGTGGAAGCCTCTTCTCAGGGCACGTTTCGACCCGACAGAGAGAAGGACGAGCTGTCACTCGCCCTGCAGACTCTAGAGCATCCAGGA[C/T]
GAACACAAGGGAAAGTGGTGATTCCTTAGAAGATTGGGTTCAAGGAGGACATCCACATGTACAGGAGTCGGATGAGGAGTAAGAGAGATACCGAGGCGAA

Reverse complement sequence

TTCGCCTCGGTATCTCTCTTACTCCTCATCCGACTCCTGTACATGTGGATGTCCTCCTTGAACCCAATCTTCTAAGGAATCACCACTTTCCCTTGTGTTC[G/A]
TCCTGGATGCTCTAGAGTCTGCAGGGCGAGTGACAGCTCGTCCTTCTCTCTGTCGGGTCGAAACGTGCCCTGAGAAGAGGCTTCCACTGTGTCCGTTAGT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 41.50% 27.70% 20.19% 10.58% NA
All Indica  2759 18.60% 38.60% 27.00% 15.80% NA
All Japonica  1512 77.80% 11.50% 8.99% 1.72% NA
Aus  269 45.40% 18.20% 23.79% 12.64% NA
Indica I  595 8.40% 29.10% 41.85% 20.67% NA
Indica II  465 28.80% 48.20% 15.05% 7.96% NA
Indica III  913 27.30% 39.90% 19.61% 13.25% NA
Indica Intermediate  786 10.30% 38.50% 31.42% 19.72% NA
Temperate Japonica  767 94.00% 3.90% 1.69% 0.39% NA
Tropical Japonica  504 51.80% 25.20% 19.25% 3.77% NA
Japonica Intermediate  241 80.50% 7.10% 10.79% 1.66% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 61.10% 24.40% 10.00% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0515177250 C -> T LOC_Os05g26110.1 upstream_gene_variant ; 4255.0bp to feature; MODIFIER silent_mutation Average:26.189; most accessible tissue: Zhenshan97 panicle, score: 39.652 N N N N
vg0515177250 C -> T LOC_Os05g26090.1 downstream_gene_variant ; 4214.0bp to feature; MODIFIER silent_mutation Average:26.189; most accessible tissue: Zhenshan97 panicle, score: 39.652 N N N N
vg0515177250 C -> T LOC_Os05g26100.1 intron_variant ; MODIFIER silent_mutation Average:26.189; most accessible tissue: Zhenshan97 panicle, score: 39.652 N N N N
vg0515177250 C -> DEL N N silent_mutation Average:26.189; most accessible tissue: Zhenshan97 panicle, score: 39.652 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0515177250 NA 1.23E-07 mr1206 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515177250 NA 2.93E-07 mr1229 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515177250 NA 6.70E-08 mr1243 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515177250 NA 1.62E-08 mr1423 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515177250 NA 6.57E-06 mr1555 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515177250 NA 2.35E-06 mr1596 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515177250 NA 2.87E-16 mr1699 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515177250 NA 1.82E-07 mr1746 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515177250 NA 3.16E-09 mr1862 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515177250 NA 1.03E-06 mr1039_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515177250 6.61E-06 2.08E-14 mr1217_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515177250 3.75E-06 1.41E-08 mr1217_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515177250 NA 3.51E-06 mr1705_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515177250 NA 3.29E-09 mr1835_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515177250 NA 3.96E-06 mr1860_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515177250 NA 1.83E-06 mr1869_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515177250 NA 3.45E-06 mr1873_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515177250 NA 2.42E-07 mr1885_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515177250 NA 1.13E-06 mr1905_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515177250 NA 7.89E-10 mr1916_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251