Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0514667369:

Variant ID: vg0514667369 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 14667369
Reference Allele: GAlternative Allele: T,A
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 241. )

Flanking Sequence (100 bp) in Reference Genome:


TATTCATACAACGAAGACCACTGTTATCAGCAGTCTCAACAAGTCATATAGGATAGAACTACACAAATATCACAACACTCACTATGGAAAGCACTGTAAA[G/T,A]
TATATTTGTGTTTCAGTCCCTACTTATTTACGTGTCAGTACTTCTAATATATTTTATTATCAACATTTGTATTTTGGATCTTCTAATAACAAAAAGAGTA

Reverse complement sequence

TACTCTTTTTGTTATTAGAAGATCCAAAATACAAATGTTGATAATAAAATATATTAGAAGTACTGACACGTAAATAAGTAGGGACTGAAACACAAATATA[C/A,T]
TTTACAGTGCTTTCCATAGTGAGTGTTGTGATATTTGTGTAGTTCTATCCTATATGACTTGTTGAGACTGCTGATAACAGTGGTCTTCGTTGTATGAATA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 89.80% 5.10% 5.06% 0.00% A: 0.04%
All Indica  2759 99.10% 0.20% 0.72% 0.00% NA
All Japonica  1512 70.40% 15.40% 14.15% 0.00% NA
Aus  269 99.60% 0.00% 0.37% 0.00% NA
Indica I  595 98.80% 0.20% 1.01% 0.00% NA
Indica II  465 96.60% 0.90% 2.58% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.70% 0.00% 0.25% 0.00% NA
Temperate Japonica  767 48.60% 28.80% 22.56% 0.00% NA
Tropical Japonica  504 96.80% 0.00% 3.17% 0.00% NA
Japonica Intermediate  241 84.60% 5.00% 10.37% 0.00% NA
VI/Aromatic  96 99.00% 0.00% 1.04% 0.00% NA
Intermediate  90 90.00% 4.40% 3.33% 0.00% A: 2.22%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0514667369 G -> T LOC_Os05g25260.1 downstream_gene_variant ; 2698.0bp to feature; MODIFIER silent_mutation Average:90.004; most accessible tissue: Minghui63 flag leaf, score: 94.569 N N N N
vg0514667369 G -> T LOC_Os05g25270.1 downstream_gene_variant ; 219.0bp to feature; MODIFIER silent_mutation Average:90.004; most accessible tissue: Minghui63 flag leaf, score: 94.569 N N N N
vg0514667369 G -> T LOC_Os05g25260-LOC_Os05g25270 intergenic_region ; MODIFIER silent_mutation Average:90.004; most accessible tissue: Minghui63 flag leaf, score: 94.569 N N N N
vg0514667369 G -> A LOC_Os05g25260.1 downstream_gene_variant ; 2698.0bp to feature; MODIFIER silent_mutation Average:90.004; most accessible tissue: Minghui63 flag leaf, score: 94.569 N N N N
vg0514667369 G -> A LOC_Os05g25270.1 downstream_gene_variant ; 219.0bp to feature; MODIFIER silent_mutation Average:90.004; most accessible tissue: Minghui63 flag leaf, score: 94.569 N N N N
vg0514667369 G -> A LOC_Os05g25260-LOC_Os05g25270 intergenic_region ; MODIFIER silent_mutation Average:90.004; most accessible tissue: Minghui63 flag leaf, score: 94.569 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0514667369 G A 0.01 0.0 0.0 -0.03 -0.01 -0.01
vg0514667369 G T 0.02 0.0 0.0 -0.04 -0.02 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0514667369 NA 3.62E-09 mr1137 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514667369 NA 9.99E-06 mr1164 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514667369 NA 9.11E-07 mr1555 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514667369 NA 2.85E-09 mr1617 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514667369 NA 3.41E-07 mr1627 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514667369 5.36E-08 5.07E-32 mr1137_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514667369 NA 1.51E-12 mr1137_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514667369 NA 5.06E-06 mr1161_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514667369 NA 7.96E-06 mr1206_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514667369 NA 2.02E-06 mr1206_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514667369 NA 1.96E-09 mr1229_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514667369 NA 2.10E-08 mr1229_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514667369 NA 1.78E-07 mr1252_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514667369 NA 1.49E-08 mr1570_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514667369 2.74E-07 NA mr1617_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514667369 NA 1.20E-10 mr1617_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514667369 NA 2.75E-07 mr1627_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514667369 NA 1.89E-07 mr1693_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514667369 NA 7.53E-06 mr1693_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514667369 NA 4.79E-07 mr1763_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514667369 NA 2.38E-09 mr1880_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514667369 NA 2.29E-08 mr1880_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251