\
| Variant ID: vg0514024444 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 14024444 |
| Reference Allele: G | Alternative Allele: T |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.67, G: 0.33, others allele: 0.00, population size: 236. )
TGCGGTGGGCCAGAAAAAACCCTGCCGATAAGCCTTGCCAACGATGGTTCGTGCGCCAGCGTGATTCCCACGAATGCCCGAGTGGATATCCTTTAGCAAT[G/T]
GCCTTCCCTCCTCCAAAGAAACACAGCGTTGCAGAACTCCTGATGGGCTCTTCTTATACAGCTCGGTCTCATGTATGACATAAAGCTTGCTGCGCCTGGA
TCCAGGCGCAGCAAGCTTTATGTCATACATGAGACCGAGCTGTATAAGAAGAGCCCATCAGGAGTTCTGCAACGCTGTGTTTCTTTGGAGGAGGGAAGGC[C/A]
ATTGCTAAAGGATATCCACTCGGGCATTCGTGGGAATCACGCTGGCGCACGAACCATCGTTGGCAAGGCTTATCGGCAGGGTTTTTTCTGGCCCACCGCA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 86.90% | 13.10% | 0.00% | 0.00% | NA |
| All Indica | 2759 | 86.00% | 14.00% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| Aus | 269 | 20.10% | 79.90% | 0.00% | 0.00% | NA |
| Indica I | 595 | 80.80% | 19.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.10% | 0.90% | 0.00% | 0.00% | NA |
| Indica III | 913 | 79.60% | 20.40% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 89.70% | 10.30% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 98.00% | 2.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 92.20% | 7.80% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0514024444 | G -> T | LOC_Os05g24250.1 | missense_variant ; p.Pro240Gln; MODERATE | nonsynonymous_codon ; P240Q | Average:52.458; most accessible tissue: Zhenshan97 flag leaf, score: 68.25 | possibly damaging |
-1.637 |
TOLERATED | 1.00 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0514024444 | NA | 1.72E-09 | mr1608 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0514024444 | NA | 7.31E-13 | mr1897 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0514024444 | 5.68E-06 | 5.68E-06 | mr1025_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0514024444 | 4.95E-06 | NA | mr1235_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0514024444 | 2.61E-06 | 8.49E-06 | mr1252_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0514024444 | NA | 5.50E-07 | mr1344_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0514024444 | NA | 5.82E-06 | mr1376_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0514024444 | NA | 1.63E-09 | mr1388_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0514024444 | NA | 8.96E-06 | mr1415_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0514024444 | NA | 7.14E-06 | mr1431_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0514024444 | NA | 8.01E-06 | mr1554_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0514024444 | NA | 8.11E-06 | mr1759_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0514024444 | NA | 7.52E-06 | mr1854_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0514024444 | NA | 9.51E-06 | mr1876_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0514024444 | NA | 2.35E-06 | mr1930_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |