Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0508706913:

Variant ID: vg0508706913 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 8706913
Reference Allele: A	Alternative Allele: C
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TACCCAGAATTACATAAGATGTCCTTGTCGGACACGACTCCTATCTAATAAGGAAACTAACAAAATATCCTAATTAATAGATATAATTGCCTTTTCCAGA[A/C]
TTAATCCGCACGTGGCAATCCTCATGAAGCACACCAACCGAATCCGACAATGATCCAACCTTCTCTCTATCGGAATCGGTTACATCGGCTATCCTACTCC

Reverse complement sequence

GGAGTAGGATAGCCGATGTAACCGATTCCGATAGAGAGAAGGTTGGATCATTGTCGGATTCGGTTGGTGTGCTTCATGAGGATTGCCACGTGCGGATTAA[T/G]
TCTGGAAAAGGCAATTATATCTATTAATTAGGATATTTTGTTAGTTTCCTTATTAGATAGGAGTCGTGTCCGACAAGGACATCTTATGTAATTCTGGGTA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	83.60%	9.70%	6.75%	0.00%	NA
All Indica	2759	95.00%	1.20%	3.88%	0.00%	NA
All Japonica	1512	58.80%	27.70%	13.49%	0.00%	NA
Aus	269	99.30%	0.40%	0.37%	0.00%	NA
Indica I	595	86.40%	3.00%	10.59%	0.00%	NA
Indica II	465	94.40%	1.70%	3.87%	0.00%	NA
Indica III	913	99.90%	0.10%	0.00%	0.00%	NA
Indica Intermediate	786	96.10%	0.60%	3.31%	0.00%	NA
Temperate Japonica	767	30.40%	51.20%	18.38%	0.00%	NA
Tropical Japonica	504	92.10%	2.00%	5.95%	0.00%	NA
Japonica Intermediate	241	79.70%	6.60%	13.69%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	86.70%	5.60%	7.78%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0508706913	A -> C	LOC_Os05g15370.1	upstream_gene_variant ; 2904.0bp to feature; MODIFIER	silent_mutation	Average:29.495; most accessible tissue: Minghui63 panicle, score: 50.413	N	N	N	N
vg0508706913	A -> C	LOC_Os05g15390.1	upstream_gene_variant ; 505.0bp to feature; MODIFIER	silent_mutation	Average:29.495; most accessible tissue: Minghui63 panicle, score: 50.413	N	N	N	N
vg0508706913	A -> C	LOC_Os05g15400.1	upstream_gene_variant ; 2787.0bp to feature; MODIFIER	silent_mutation	Average:29.495; most accessible tissue: Minghui63 panicle, score: 50.413	N	N	N	N
vg0508706913	A -> C	LOC_Os05g15380.1	downstream_gene_variant ; 529.0bp to feature; MODIFIER	silent_mutation	Average:29.495; most accessible tissue: Minghui63 panicle, score: 50.413	N	N	N	N
vg0508706913	A -> C	LOC_Os05g15380-LOC_Os05g15390	intergenic_region ; MODIFIER	silent_mutation	Average:29.495; most accessible tissue: Minghui63 panicle, score: 50.413	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0508706913	NA	1.79E-06	mr1026	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0508706913	1.71E-06	5.66E-34	mr1137	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0508706913	NA	1.90E-12	mr1137	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0508706913	NA	9.23E-06	mr1576	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0508706913	3.59E-07	2.85E-30	mr1617	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0508706913	NA	1.00E-11	mr1617	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0508706913	NA	2.04E-10	mr1627	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0508706913	NA	3.59E-06	mr1937	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0508706913	NA	8.98E-08	mr1977	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0508706913	NA	3.51E-06	mr1977	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0508706913	3.79E-12	4.61E-43	mr1137_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0508706913	9.51E-07	5.00E-15	mr1137_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0508706913	NA	7.23E-07	mr1521_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0508706913	NA	3.36E-07	mr1570_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0508706913	5.07E-09	2.52E-30	mr1617_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0508706913	NA	3.58E-11	mr1617_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251