\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0508706913:

Variant ID: vg0508706913 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 8706913
Reference Allele: AAlternative Allele: C
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TACCCAGAATTACATAAGATGTCCTTGTCGGACACGACTCCTATCTAATAAGGAAACTAACAAAATATCCTAATTAATAGATATAATTGCCTTTTCCAGA[A/C]
TTAATCCGCACGTGGCAATCCTCATGAAGCACACCAACCGAATCCGACAATGATCCAACCTTCTCTCTATCGGAATCGGTTACATCGGCTATCCTACTCC

Reverse complement sequence

GGAGTAGGATAGCCGATGTAACCGATTCCGATAGAGAGAAGGTTGGATCATTGTCGGATTCGGTTGGTGTGCTTCATGAGGATTGCCACGTGCGGATTAA[T/G]
TCTGGAAAAGGCAATTATATCTATTAATTAGGATATTTTGTTAGTTTCCTTATTAGATAGGAGTCGTGTCCGACAAGGACATCTTATGTAATTCTGGGTA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 83.60% 9.70% 6.75% 0.00% NA
All Indica  2759 95.00% 1.20% 3.88% 0.00% NA
All Japonica  1512 58.80% 27.70% 13.49% 0.00% NA
Aus  269 99.30% 0.40% 0.37% 0.00% NA
Indica I  595 86.40% 3.00% 10.59% 0.00% NA
Indica II  465 94.40% 1.70% 3.87% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 96.10% 0.60% 3.31% 0.00% NA
Temperate Japonica  767 30.40% 51.20% 18.38% 0.00% NA
Tropical Japonica  504 92.10% 2.00% 5.95% 0.00% NA
Japonica Intermediate  241 79.70% 6.60% 13.69% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 86.70% 5.60% 7.78% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0508706913 A -> C LOC_Os05g15370.1 upstream_gene_variant ; 2904.0bp to feature; MODIFIER silent_mutation Average:29.495; most accessible tissue: Minghui63 panicle, score: 50.413 N N N N
vg0508706913 A -> C LOC_Os05g15390.1 upstream_gene_variant ; 505.0bp to feature; MODIFIER silent_mutation Average:29.495; most accessible tissue: Minghui63 panicle, score: 50.413 N N N N
vg0508706913 A -> C LOC_Os05g15400.1 upstream_gene_variant ; 2787.0bp to feature; MODIFIER silent_mutation Average:29.495; most accessible tissue: Minghui63 panicle, score: 50.413 N N N N
vg0508706913 A -> C LOC_Os05g15380.1 downstream_gene_variant ; 529.0bp to feature; MODIFIER silent_mutation Average:29.495; most accessible tissue: Minghui63 panicle, score: 50.413 N N N N
vg0508706913 A -> C LOC_Os05g15380-LOC_Os05g15390 intergenic_region ; MODIFIER silent_mutation Average:29.495; most accessible tissue: Minghui63 panicle, score: 50.413 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0508706913 NA 1.79E-06 mr1026 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0508706913 1.71E-06 5.66E-34 mr1137 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0508706913 NA 1.90E-12 mr1137 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0508706913 NA 9.23E-06 mr1576 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0508706913 3.59E-07 2.85E-30 mr1617 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0508706913 NA 1.00E-11 mr1617 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0508706913 NA 2.04E-10 mr1627 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0508706913 NA 3.59E-06 mr1937 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0508706913 NA 8.98E-08 mr1977 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0508706913 NA 3.51E-06 mr1977 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0508706913 3.79E-12 4.61E-43 mr1137_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0508706913 9.51E-07 5.00E-15 mr1137_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0508706913 NA 7.23E-07 mr1521_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0508706913 NA 3.36E-07 mr1570_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0508706913 5.07E-09 2.52E-30 mr1617_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0508706913 NA 3.58E-11 mr1617_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251