\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0507714473:

Variant ID: vg0507714473 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 7714473
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 213. )

Flanking Sequence (100 bp) in Reference Genome:


TATTTCTTGCAAAATATTATGCATTGCTAGGATTGCACTTAATATGTTTGCCCCATCTACGAGGCAGATCGGTGAGCATACCTAACTTGTTGCATTTGAT[C/T]
CTTCCATTGTTAATTGTTATATCATGTTTCCTTGTAACCACCTGGTCACGCCTCGATATTCGTGCACTCTGTGCGAGTATCGACGGTCGCCTTCAAACTT

Reverse complement sequence

AAGTTTGAAGGCGACCGTCGATACTCGCACAGAGTGCACGAATATCGAGGCGTGACCAGGTGGTTACAAGGAAACATGATATAACAATTAACAATGGAAG[G/A]
ATCAAATGCAACAAGTTAGGTATGCTCACCGATCTGCCTCGTAGATGGGGCAAACATATTAAGTGCAATCCTAGCAATGCATAATATTTTGCAAGAAATA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 84.50% 2.90% 5.92% 6.69% NA
All Indica  2759 75.60% 4.90% 9.50% 10.00% NA
All Japonica  1512 98.30% 0.10% 0.20% 1.46% NA
Aus  269 92.60% 0.00% 3.35% 4.09% NA
Indica I  595 57.60% 13.10% 23.53% 5.71% NA
Indica II  465 73.10% 7.70% 8.60% 10.54% NA
Indica III  913 86.90% 0.20% 1.64% 11.28% NA
Indica Intermediate  786 77.70% 2.30% 8.52% 11.45% NA
Temperate Japonica  767 98.80% 0.10% 0.13% 0.91% NA
Tropical Japonica  504 96.60% 0.00% 0.40% 2.98% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 85.60% 0.00% 6.67% 7.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0507714473 C -> T LOC_Os05g13870.1 upstream_gene_variant ; 3928.0bp to feature; MODIFIER silent_mutation Average:28.454; most accessible tissue: Zhenshan97 flower, score: 69.089 N N N N
vg0507714473 C -> T LOC_Os05g13890.1 upstream_gene_variant ; 1474.0bp to feature; MODIFIER silent_mutation Average:28.454; most accessible tissue: Zhenshan97 flower, score: 69.089 N N N N
vg0507714473 C -> T LOC_Os05g13880.1 downstream_gene_variant ; 905.0bp to feature; MODIFIER silent_mutation Average:28.454; most accessible tissue: Zhenshan97 flower, score: 69.089 N N N N
vg0507714473 C -> T LOC_Os05g13880-LOC_Os05g13890 intergenic_region ; MODIFIER silent_mutation Average:28.454; most accessible tissue: Zhenshan97 flower, score: 69.089 N N N N
vg0507714473 C -> DEL N N silent_mutation Average:28.454; most accessible tissue: Zhenshan97 flower, score: 69.089 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0507714473 4.25E-10 1.37E-19 mr1191 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507714473 3.40E-10 1.74E-14 mr1191 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507714473 7.37E-12 3.86E-22 mr1644 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507714473 1.82E-10 1.10E-16 mr1644 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507714473 6.48E-08 9.94E-11 mr1662 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507714473 3.82E-07 1.63E-10 mr1662 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507714473 NA 3.07E-06 mr1745 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507714473 1.63E-14 3.09E-36 mr1191_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507714473 2.04E-13 1.40E-26 mr1191_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507714473 NA 7.66E-06 mr1380_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507714473 4.02E-06 1.36E-11 mr1662_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507714473 1.50E-06 1.65E-11 mr1662_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507714473 NA 6.60E-09 mr1745_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507714473 NA 2.52E-06 mr1875_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507714473 NA 9.38E-07 mr1908_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251