Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0507714473:

Variant ID: vg0507714473 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 7714473
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 213. )

Flanking Sequence (100 bp) in Reference Genome:

TATTTCTTGCAAAATATTATGCATTGCTAGGATTGCACTTAATATGTTTGCCCCATCTACGAGGCAGATCGGTGAGCATACCTAACTTGTTGCATTTGAT[C/T]
CTTCCATTGTTAATTGTTATATCATGTTTCCTTGTAACCACCTGGTCACGCCTCGATATTCGTGCACTCTGTGCGAGTATCGACGGTCGCCTTCAAACTT

Reverse complement sequence

AAGTTTGAAGGCGACCGTCGATACTCGCACAGAGTGCACGAATATCGAGGCGTGACCAGGTGGTTACAAGGAAACATGATATAACAATTAACAATGGAAG[G/A]
ATCAAATGCAACAAGTTAGGTATGCTCACCGATCTGCCTCGTAGATGGGGCAAACATATTAAGTGCAATCCTAGCAATGCATAATATTTTGCAAGAAATA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	84.50%	2.90%	5.92%	6.69%	NA
All Indica	2759	75.60%	4.90%	9.50%	10.00%	NA
All Japonica	1512	98.30%	0.10%	0.20%	1.46%	NA
Aus	269	92.60%	0.00%	3.35%	4.09%	NA
Indica I	595	57.60%	13.10%	23.53%	5.71%	NA
Indica II	465	73.10%	7.70%	8.60%	10.54%	NA
Indica III	913	86.90%	0.20%	1.64%	11.28%	NA
Indica Intermediate	786	77.70%	2.30%	8.52%	11.45%	NA
Temperate Japonica	767	98.80%	0.10%	0.13%	0.91%	NA
Tropical Japonica	504	96.60%	0.00%	0.40%	2.98%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	85.60%	0.00%	6.67%	7.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0507714473	C -> T	LOC_Os05g13870.1	upstream_gene_variant ; 3928.0bp to feature; MODIFIER	silent_mutation	Average:28.454; most accessible tissue: Zhenshan97 flower, score: 69.089	N	N	N	N
vg0507714473	C -> T	LOC_Os05g13890.1	upstream_gene_variant ; 1474.0bp to feature; MODIFIER	silent_mutation	Average:28.454; most accessible tissue: Zhenshan97 flower, score: 69.089	N	N	N	N
vg0507714473	C -> T	LOC_Os05g13880.1	downstream_gene_variant ; 905.0bp to feature; MODIFIER	silent_mutation	Average:28.454; most accessible tissue: Zhenshan97 flower, score: 69.089	N	N	N	N
vg0507714473	C -> T	LOC_Os05g13880-LOC_Os05g13890	intergenic_region ; MODIFIER	silent_mutation	Average:28.454; most accessible tissue: Zhenshan97 flower, score: 69.089	N	N	N	N
vg0507714473	C -> DEL	N	N	silent_mutation	Average:28.454; most accessible tissue: Zhenshan97 flower, score: 69.089	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0507714473	4.25E-10	1.37E-19	mr1191	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507714473	3.40E-10	1.74E-14	mr1191	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507714473	7.37E-12	3.86E-22	mr1644	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507714473	1.82E-10	1.10E-16	mr1644	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507714473	6.48E-08	9.94E-11	mr1662	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507714473	3.82E-07	1.63E-10	mr1662	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507714473	NA	3.07E-06	mr1745	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507714473	1.63E-14	3.09E-36	mr1191_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507714473	2.04E-13	1.40E-26	mr1191_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507714473	NA	7.66E-06	mr1380_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507714473	4.02E-06	1.36E-11	mr1662_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507714473	1.50E-06	1.65E-11	mr1662_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507714473	NA	6.60E-09	mr1745_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507714473	NA	2.52E-06	mr1875_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507714473	NA	9.38E-07	mr1908_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251