\
| Variant ID: vg0507579091 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 7579091 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.83, A: 0.17, others allele: 0.00, population size: 103. )
GGTTTTTGTCGGTATCGGCTAAATTGTTTTACTATATTAGATTAGCTAAGGCATCTACCACCCTAAAAATCAGTCCAGGGCTTGATTGTCTAGATATTAT[A/G]
TTTCTTTTTATACTTAGTGCTGCATCAGTTAAGTTTGATCTACTAAGTTGTGTTTAGAACCATATTCTCTAGCCTGCTTCTTGATTGCCAATAAGGATTT
AAATCCTTATTGGCAATCAAGAAGCAGGCTAGAGAATATGGTTCTAAACACAACTTAGTAGATCAAACTTAACTGATGCAGCACTAAGTATAAAAAGAAA[T/C]
ATAATATCTAGACAATCAAGCCCTGGACTGATTTTTAGGGTGGTAGATGCCTTAGCTAATCTAATATAGTAAAACAATTTAGCCGATACCGACAAAAACC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 44.90% | 12.00% | 1.33% | 41.81% | NA |
| All Indica | 2759 | 23.00% | 5.90% | 2.25% | 68.90% | NA |
| All Japonica | 1512 | 90.30% | 8.70% | 0.00% | 0.99% | NA |
| Aus | 269 | 19.30% | 66.50% | 0.37% | 13.75% | NA |
| Indica I | 595 | 19.20% | 0.30% | 2.18% | 78.32% | NA |
| Indica II | 465 | 32.50% | 2.80% | 1.29% | 63.44% | NA |
| Indica III | 913 | 20.90% | 6.70% | 0.99% | 71.41% | NA |
| Indica Intermediate | 786 | 22.60% | 10.90% | 4.33% | 62.09% | NA |
| Temperate Japonica | 767 | 97.80% | 0.80% | 0.00% | 1.43% | NA |
| Tropical Japonica | 504 | 79.00% | 20.40% | 0.00% | 0.60% | NA |
| Japonica Intermediate | 241 | 90.00% | 9.50% | 0.00% | 0.41% | NA |
| VI/Aromatic | 96 | 22.90% | 77.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 53.30% | 21.10% | 0.00% | 25.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0507579091 | A -> DEL | N | N | silent_mutation | Average:9.708; most accessible tissue: Callus, score: 22.696 | N | N | N | N |
| vg0507579091 | A -> G | LOC_Os05g13680.1 | upstream_gene_variant ; 1405.0bp to feature; MODIFIER | silent_mutation | Average:9.708; most accessible tissue: Callus, score: 22.696 | N | N | N | N |
| vg0507579091 | A -> G | LOC_Os05g13670-LOC_Os05g13680 | intergenic_region ; MODIFIER | silent_mutation | Average:9.708; most accessible tissue: Callus, score: 22.696 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0507579091 | NA | 8.21E-08 | mr1942 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507579091 | 9.98E-06 | 3.23E-07 | mr1047_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507579091 | NA | 3.04E-08 | mr1126_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507579091 | 5.39E-08 | 1.62E-10 | mr1530_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507579091 | NA | 4.83E-07 | mr1567_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507579091 | NA | 2.35E-08 | mr1642_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |