\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0507579091:

Variant ID: vg0507579091 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 7579091
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.83, A: 0.17, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:


GGTTTTTGTCGGTATCGGCTAAATTGTTTTACTATATTAGATTAGCTAAGGCATCTACCACCCTAAAAATCAGTCCAGGGCTTGATTGTCTAGATATTAT[A/G]
TTTCTTTTTATACTTAGTGCTGCATCAGTTAAGTTTGATCTACTAAGTTGTGTTTAGAACCATATTCTCTAGCCTGCTTCTTGATTGCCAATAAGGATTT

Reverse complement sequence

AAATCCTTATTGGCAATCAAGAAGCAGGCTAGAGAATATGGTTCTAAACACAACTTAGTAGATCAAACTTAACTGATGCAGCACTAAGTATAAAAAGAAA[T/C]
ATAATATCTAGACAATCAAGCCCTGGACTGATTTTTAGGGTGGTAGATGCCTTAGCTAATCTAATATAGTAAAACAATTTAGCCGATACCGACAAAAACC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 44.90% 12.00% 1.33% 41.81% NA
All Indica  2759 23.00% 5.90% 2.25% 68.90% NA
All Japonica  1512 90.30% 8.70% 0.00% 0.99% NA
Aus  269 19.30% 66.50% 0.37% 13.75% NA
Indica I  595 19.20% 0.30% 2.18% 78.32% NA
Indica II  465 32.50% 2.80% 1.29% 63.44% NA
Indica III  913 20.90% 6.70% 0.99% 71.41% NA
Indica Intermediate  786 22.60% 10.90% 4.33% 62.09% NA
Temperate Japonica  767 97.80% 0.80% 0.00% 1.43% NA
Tropical Japonica  504 79.00% 20.40% 0.00% 0.60% NA
Japonica Intermediate  241 90.00% 9.50% 0.00% 0.41% NA
VI/Aromatic  96 22.90% 77.10% 0.00% 0.00% NA
Intermediate  90 53.30% 21.10% 0.00% 25.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0507579091 A -> DEL N N silent_mutation Average:9.708; most accessible tissue: Callus, score: 22.696 N N N N
vg0507579091 A -> G LOC_Os05g13680.1 upstream_gene_variant ; 1405.0bp to feature; MODIFIER silent_mutation Average:9.708; most accessible tissue: Callus, score: 22.696 N N N N
vg0507579091 A -> G LOC_Os05g13670-LOC_Os05g13680 intergenic_region ; MODIFIER silent_mutation Average:9.708; most accessible tissue: Callus, score: 22.696 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0507579091 NA 8.21E-08 mr1942 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507579091 9.98E-06 3.23E-07 mr1047_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507579091 NA 3.04E-08 mr1126_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507579091 5.39E-08 1.62E-10 mr1530_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507579091 NA 4.83E-07 mr1567_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507579091 NA 2.35E-08 mr1642_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251