Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0507156565:

Variant ID: vg0507156565 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 7156565
Reference Allele: A	Alternative Allele: T
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.70, A: 0.31, others allele: 0.00, population size: 86. )

Flanking Sequence (100 bp) in Reference Genome:

TTCAAAAAATTTAAGTAATTATCATTTATTTTATTGTGACTTGATTCGTCATCAAATGTTCTTTAAACATGACATAAATATTTTCATATTTGCACAAAAA[A/T]
TTTAAATAAAATAAAAGGTCAAACGTTAGTTGAAAAGTCAACGACATCGTACATTAAAATATGGAGGGAGTATTTATTTGTTGAAAATGATTGCTTAAAC

Reverse complement sequence

GTTTAAGCAATCATTTTCAACAAATAAATACTCCCTCCATATTTTAATGTACGATGTCGTTGACTTTTCAACTAACGTTTGACCTTTTATTTTATTTAAA[T/A]
TTTTTGTGCAAATATGAAAATATTTATGTCATGTTTAAAGAACATTTGATGACGAATCAAGTCACAATAAAATAAATGATAATTACTTAAATTTTTTGAA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	68.00%	28.30%	3.75%	0.00%	NA
All Indica	2759	56.20%	37.80%	6.02%	0.00%	NA
All Japonica	1512	95.90%	3.70%	0.40%	0.00%	NA
Aus	269	20.10%	78.80%	1.12%	0.00%	NA
Indica I	595	62.20%	22.00%	15.80%	0.00%	NA
Indica II	465	77.20%	20.60%	2.15%	0.00%	NA
Indica III	913	49.10%	49.40%	1.53%	0.00%	NA
Indica Intermediate	786	47.60%	46.30%	6.11%	0.00%	NA
Temperate Japonica	767	99.50%	0.40%	0.13%	0.00%	NA
Tropical Japonica	504	95.40%	4.00%	0.60%	0.00%	NA
Japonica Intermediate	241	85.50%	13.70%	0.83%	0.00%	NA
VI/Aromatic	96	97.90%	2.10%	0.00%	0.00%	NA
Intermediate	90	71.10%	26.70%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0507156565	A -> T	LOC_Os05g12450.1	downstream_gene_variant ; 2623.0bp to feature; MODIFIER	silent_mutation	Average:43.94; most accessible tissue: Callus, score: 68.486	N	N	N	N
vg0507156565	A -> T	LOC_Os05g12460.1	downstream_gene_variant ; 1639.0bp to feature; MODIFIER	silent_mutation	Average:43.94; most accessible tissue: Callus, score: 68.486	N	N	N	N
vg0507156565	A -> T	LOC_Os05g12450-LOC_Os05g12460	intergenic_region ; MODIFIER	silent_mutation	Average:43.94; most accessible tissue: Callus, score: 68.486	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0507156565	9.45E-06	NA	mr1593	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507156565	2.37E-07	5.87E-11	mr1593	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507156565	NA	5.56E-08	mr1133_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507156565	2.92E-06	1.63E-10	mr1593_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507156565	NA	3.51E-06	mr1667_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507156565	NA	1.79E-06	mr1807_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251