\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0505332267:

Variant ID: vg0505332267 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 5332267
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GATTGCTTATCTAGAGAAGAATAAATAGCCTTTTACGGTCCTTGTTAGTACTAGTATTAGGCTATTGGGACCACCTATACATTTGTCGACAAATTTTCTC[C/T]
TAAAAATTTGATAAATGTAATTATAATACAATCGTAGTGTAATTACAATGTAACTTAAATGTAATTACAGTGTAACTTACATGTAACTACAGTGTAACTT

Reverse complement sequence

AAGTTACACTGTAGTTACATGTAAGTTACACTGTAATTACATTTAAGTTACATTGTAATTACACTACGATTGTATTATAATTACATTTATCAAATTTTTA[G/A]
GAGAAAATTTGTCGACAAATGTATAGGTGGTCCCAATAGCCTAATACTAGTACTAACAAGGACCGTAAAAGGCTATTTATTCTTCTCTAGATAAGCAATC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 91.80% 8.10% 0.06% 0.00% NA
All Indica  2759 98.50% 1.50% 0.00% 0.00% NA
All Japonica  1512 78.20% 21.60% 0.20% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 97.00% 3.00% 0.00% 0.00% NA
Indica III  913 99.50% 0.50% 0.00% 0.00% NA
Indica Intermediate  786 97.10% 2.90% 0.00% 0.00% NA
Temperate Japonica  767 94.70% 5.30% 0.00% 0.00% NA
Tropical Japonica  504 54.60% 44.80% 0.60% 0.00% NA
Japonica Intermediate  241 75.50% 24.50% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 83.30% 16.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0505332267 C -> T LOC_Os05g09490.1 upstream_gene_variant ; 1459.0bp to feature; MODIFIER silent_mutation Average:63.53; most accessible tissue: Callus, score: 85.671 N N N N
vg0505332267 C -> T LOC_Os05g09490.2 upstream_gene_variant ; 1511.0bp to feature; MODIFIER silent_mutation Average:63.53; most accessible tissue: Callus, score: 85.671 N N N N
vg0505332267 C -> T LOC_Os05g09480.1 downstream_gene_variant ; 777.0bp to feature; MODIFIER silent_mutation Average:63.53; most accessible tissue: Callus, score: 85.671 N N N N
vg0505332267 C -> T LOC_Os05g09500.1 downstream_gene_variant ; 4928.0bp to feature; MODIFIER silent_mutation Average:63.53; most accessible tissue: Callus, score: 85.671 N N N N
vg0505332267 C -> T LOC_Os05g09480-LOC_Os05g09490 intergenic_region ; MODIFIER silent_mutation Average:63.53; most accessible tissue: Callus, score: 85.671 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0505332267 4.65E-07 NA Grain_thickness All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0505332267 1.56E-06 2.86E-15 Grain_thickness Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0505332267 3.77E-10 NA Grain_width All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0505332267 1.76E-11 2.74E-19 Grain_width Jap_All YES Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0505332267 NA 8.37E-07 mr1248 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505332267 NA 3.98E-28 mr1699 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505332267 NA 1.53E-07 mr1733 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505332267 NA 2.62E-13 mr1769 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505332267 NA 3.73E-11 mr1784 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505332267 NA 5.34E-29 mr1699_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505332267 NA 5.52E-13 mr1769_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505332267 NA 1.08E-09 mr1771_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251