\
| Variant ID: vg0505332267 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 5332267 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
GATTGCTTATCTAGAGAAGAATAAATAGCCTTTTACGGTCCTTGTTAGTACTAGTATTAGGCTATTGGGACCACCTATACATTTGTCGACAAATTTTCTC[C/T]
TAAAAATTTGATAAATGTAATTATAATACAATCGTAGTGTAATTACAATGTAACTTAAATGTAATTACAGTGTAACTTACATGTAACTACAGTGTAACTT
AAGTTACACTGTAGTTACATGTAAGTTACACTGTAATTACATTTAAGTTACATTGTAATTACACTACGATTGTATTATAATTACATTTATCAAATTTTTA[G/A]
GAGAAAATTTGTCGACAAATGTATAGGTGGTCCCAATAGCCTAATACTAGTACTAACAAGGACCGTAAAAGGCTATTTATTCTTCTCTAGATAAGCAATC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 91.80% | 8.10% | 0.06% | 0.00% | NA |
| All Indica | 2759 | 98.50% | 1.50% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 78.20% | 21.60% | 0.20% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 97.00% | 3.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 97.10% | 2.90% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 94.70% | 5.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 54.60% | 44.80% | 0.60% | 0.00% | NA |
| Japonica Intermediate | 241 | 75.50% | 24.50% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 83.30% | 16.70% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0505332267 | C -> T | LOC_Os05g09490.1 | upstream_gene_variant ; 1459.0bp to feature; MODIFIER | silent_mutation | Average:63.53; most accessible tissue: Callus, score: 85.671 | N | N | N | N |
| vg0505332267 | C -> T | LOC_Os05g09490.2 | upstream_gene_variant ; 1511.0bp to feature; MODIFIER | silent_mutation | Average:63.53; most accessible tissue: Callus, score: 85.671 | N | N | N | N |
| vg0505332267 | C -> T | LOC_Os05g09480.1 | downstream_gene_variant ; 777.0bp to feature; MODIFIER | silent_mutation | Average:63.53; most accessible tissue: Callus, score: 85.671 | N | N | N | N |
| vg0505332267 | C -> T | LOC_Os05g09500.1 | downstream_gene_variant ; 4928.0bp to feature; MODIFIER | silent_mutation | Average:63.53; most accessible tissue: Callus, score: 85.671 | N | N | N | N |
| vg0505332267 | C -> T | LOC_Os05g09480-LOC_Os05g09490 | intergenic_region ; MODIFIER | silent_mutation | Average:63.53; most accessible tissue: Callus, score: 85.671 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0505332267 | 4.65E-07 | NA | Grain_thickness | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0505332267 | 1.56E-06 | 2.86E-15 | Grain_thickness | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0505332267 | 3.77E-10 | NA | Grain_width | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0505332267 | 1.76E-11 | 2.74E-19 | Grain_width | Jap_All | YES | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0505332267 | NA | 8.37E-07 | mr1248 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0505332267 | NA | 3.98E-28 | mr1699 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0505332267 | NA | 1.53E-07 | mr1733 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0505332267 | NA | 2.62E-13 | mr1769 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0505332267 | NA | 3.73E-11 | mr1784 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0505332267 | NA | 5.34E-29 | mr1699_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0505332267 | NA | 5.52E-13 | mr1769_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0505332267 | NA | 1.08E-09 | mr1771_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |