| Variant ID: vg0503844477 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr05 | Position: 3844477 |
| Reference Allele: GATAT | Alternative Allele: GATATAT,GATATATAT,GATATATATATATAT,G |
| Primary Allele: GATAT | Secondary Allele: GATATAT |
Inferred Ancestral Allele: Not determined.
AAAAATGCACTTTTGAACATTAACTGTTGTCTTGAGCATAAACATGCAAAATGTGTATAACCAAGAATATATGATCTTCCTAGTAATGGTGCTCAAAAGA[GATAT/GATATAT,GATATATAT,GATATATATATATAT,G]
ATATATCGAGCACAAATTAGGGGAAACACCTTTAAACTCTCAAGAAATATCCCTCCTTTCCTCAGACACCATCCAAACATCCAAACAGTTATGAAAAAAG
CTTTTTTCATAACTGTTTGGATGTTTGGATGGTGTCTGAGGAAAGGAGGGATATTTCTTGAGAGTTTAAAGGTGTTTCCCCTAATTTGTGCTCGATATAT[ATATC/ATATATC,ATATATATC,ATATATATATATATC,C]
TCTTTTGAGCACCATTACTAGGAAGATCATATATTCTTGGTTATACACATTTTGCATGTTTATGCTCAAGACAACAGTTAATGTTCAAAAGTGCATTTTT
| Populations | Population Size | Frequency of GATAT(primary allele) | Frequency of GATATAT(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 92.30% | 6.10% | 0.80% | 0.00% | GATATATAT: 0.72%; GATATATATATATAT: 0.08% |
| All Indica | 2759 | 97.10% | 1.30% | 0.22% | 0.00% | GATATATAT: 1.23%; GATATATATATATAT: 0.14% |
| All Japonica | 1512 | 99.60% | 0.30% | 0.07% | 0.00% | NA |
| Aus | 269 | 12.30% | 87.40% | 0.37% | 0.00% | NA |
| Indica I | 595 | 97.80% | 0.80% | 0.34% | 0.00% | GATATATAT: 1.01% |
| Indica II | 465 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 98.00% | 0.80% | 0.22% | 0.00% | GATATATAT: 0.55%; GATATATATATATAT: 0.44% |
| Indica Intermediate | 786 | 93.90% | 2.90% | 0.25% | 0.00% | GATATATAT: 2.93% |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 97.90% | 1.70% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 63.50% | 6.20% | 30.21% | 0.00% | NA |
| Intermediate | 90 | 94.40% | 4.40% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0503844477 | GATAT -> GATATATAT | LOC_Os05g07260.1 | downstream_gene_variant ; 1313.0bp to feature; MODIFIER | silent_mutation | Average:44.501; most accessible tissue: Callus, score: 80.816 | N | N | N | N |
| vg0503844477 | GATAT -> GATATATAT | LOC_Os05g07260.2 | downstream_gene_variant ; 1324.0bp to feature; MODIFIER | silent_mutation | Average:44.501; most accessible tissue: Callus, score: 80.816 | N | N | N | N |
| vg0503844477 | GATAT -> GATATATAT | LOC_Os05g07260.4 | downstream_gene_variant ; 1324.0bp to feature; MODIFIER | silent_mutation | Average:44.501; most accessible tissue: Callus, score: 80.816 | N | N | N | N |
| vg0503844477 | GATAT -> GATATATAT | LOC_Os05g07260.3 | downstream_gene_variant ; 1313.0bp to feature; MODIFIER | silent_mutation | Average:44.501; most accessible tissue: Callus, score: 80.816 | N | N | N | N |
| vg0503844477 | GATAT -> GATATATAT | LOC_Os05g07270.1 | intron_variant ; MODIFIER | silent_mutation | Average:44.501; most accessible tissue: Callus, score: 80.816 | N | N | N | N |
| vg0503844477 | GATAT -> G | LOC_Os05g07260.1 | downstream_gene_variant ; 1309.0bp to feature; MODIFIER | N | Average:44.501; most accessible tissue: Callus, score: 80.816 | N | N | N | N |
| vg0503844477 | GATAT -> G | LOC_Os05g07260.2 | downstream_gene_variant ; 1320.0bp to feature; MODIFIER | N | Average:44.501; most accessible tissue: Callus, score: 80.816 | N | N | N | N |
| vg0503844477 | GATAT -> G | LOC_Os05g07260.4 | downstream_gene_variant ; 1320.0bp to feature; MODIFIER | N | Average:44.501; most accessible tissue: Callus, score: 80.816 | N | N | N | N |
| vg0503844477 | GATAT -> G | LOC_Os05g07260.3 | downstream_gene_variant ; 1309.0bp to feature; MODIFIER | N | Average:44.501; most accessible tissue: Callus, score: 80.816 | N | N | N | N |
| vg0503844477 | GATAT -> G | LOC_Os05g07270.1 | intron_variant ; MODIFIER | N | Average:44.501; most accessible tissue: Callus, score: 80.816 | N | N | N | N |
| vg0503844477 | GATAT -> GATATAT | LOC_Os05g07260.1 | downstream_gene_variant ; 1313.0bp to feature; MODIFIER | silent_mutation | Average:44.501; most accessible tissue: Callus, score: 80.816 | N | N | N | N |
| vg0503844477 | GATAT -> GATATAT | LOC_Os05g07260.2 | downstream_gene_variant ; 1324.0bp to feature; MODIFIER | silent_mutation | Average:44.501; most accessible tissue: Callus, score: 80.816 | N | N | N | N |
| vg0503844477 | GATAT -> GATATAT | LOC_Os05g07260.4 | downstream_gene_variant ; 1324.0bp to feature; MODIFIER | silent_mutation | Average:44.501; most accessible tissue: Callus, score: 80.816 | N | N | N | N |
| vg0503844477 | GATAT -> GATATAT | LOC_Os05g07260.3 | downstream_gene_variant ; 1313.0bp to feature; MODIFIER | silent_mutation | Average:44.501; most accessible tissue: Callus, score: 80.816 | N | N | N | N |
| vg0503844477 | GATAT -> GATATAT | LOC_Os05g07270.1 | intron_variant ; MODIFIER | silent_mutation | Average:44.501; most accessible tissue: Callus, score: 80.816 | N | N | N | N |
| vg0503844477 | GATAT -> GATATATATATATAT | LOC_Os05g07260.1 | downstream_gene_variant ; 1313.0bp to feature; MODIFIER | silent_mutation | Average:44.501; most accessible tissue: Callus, score: 80.816 | N | N | N | N |
| vg0503844477 | GATAT -> GATATATATATATAT | LOC_Os05g07260.2 | downstream_gene_variant ; 1324.0bp to feature; MODIFIER | silent_mutation | Average:44.501; most accessible tissue: Callus, score: 80.816 | N | N | N | N |
| vg0503844477 | GATAT -> GATATATATATATAT | LOC_Os05g07260.4 | downstream_gene_variant ; 1324.0bp to feature; MODIFIER | silent_mutation | Average:44.501; most accessible tissue: Callus, score: 80.816 | N | N | N | N |
| vg0503844477 | GATAT -> GATATATATATATAT | LOC_Os05g07260.3 | downstream_gene_variant ; 1313.0bp to feature; MODIFIER | silent_mutation | Average:44.501; most accessible tissue: Callus, score: 80.816 | N | N | N | N |
| vg0503844477 | GATAT -> GATATATATATATAT | LOC_Os05g07270.1 | intron_variant ; MODIFIER | silent_mutation | Average:44.501; most accessible tissue: Callus, score: 80.816 | N | N | N | N |