Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0503844345:

Variant ID: vg0503844345 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 3844345
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.63, G: 0.36, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:

GAGGATATATATTGAATCATATGCAAGAGGAGGGCCAACTAGTTAATTAATGTGTTTCACCATCACATTATAGATTTCATAAGAGATGTACTAGGATTGT[G/A]
GGAGTACTTCTCAATTTCGTTTTTTTTTAAAAAAAATGCACTTTTGAACATTAACTGTTGTCTTGAGCATAAACATGCAAAATGTGTATAACCAAGAATA

Reverse complement sequence

TATTCTTGGTTATACACATTTTGCATGTTTATGCTCAAGACAACAGTTAATGTTCAAAAGTGCATTTTTTTTAAAAAAAAACGAAATTGAGAAGTACTCC[C/T]
ACAATCCTAGTACATCTCTTATGAAATCTATAATGTGATGGTGAAACACATTAATTAACTAGTTGGCCCTCCTCTTGCATATGATTCAATATATATCCTC

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	60.60%	39.10%	0.17%	0.19%	NA
All Indica	2759	86.30%	13.20%	0.25%	0.25%	NA
All Japonica	1512	5.60%	94.40%	0.00%	0.07%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	96.60%	2.90%	0.34%	0.17%	NA
Indica II	465	74.40%	24.30%	0.86%	0.43%	NA
Indica III	913	88.00%	11.80%	0.00%	0.22%	NA
Indica Intermediate	786	83.70%	15.90%	0.13%	0.25%	NA
Temperate Japonica	767	2.50%	97.50%	0.00%	0.00%	NA
Tropical Japonica	504	2.80%	97.00%	0.00%	0.20%	NA
Japonica Intermediate	241	21.20%	78.80%	0.00%	0.00%	NA
VI/Aromatic	96	92.70%	7.30%	0.00%	0.00%	NA
Intermediate	90	43.30%	54.40%	1.11%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0503844345	G -> DEL	N	N	silent_mutation	Average:58.768; most accessible tissue: Zhenshan97 root, score: 72.671	N	N	N	N
vg0503844345	G -> A	LOC_Os05g07260.1	downstream_gene_variant ; 1176.0bp to feature; MODIFIER	silent_mutation	Average:58.768; most accessible tissue: Zhenshan97 root, score: 72.671	N	N	N	N
vg0503844345	G -> A	LOC_Os05g07260.2	downstream_gene_variant ; 1187.0bp to feature; MODIFIER	silent_mutation	Average:58.768; most accessible tissue: Zhenshan97 root, score: 72.671	N	N	N	N
vg0503844345	G -> A	LOC_Os05g07260.4	downstream_gene_variant ; 1187.0bp to feature; MODIFIER	silent_mutation	Average:58.768; most accessible tissue: Zhenshan97 root, score: 72.671	N	N	N	N
vg0503844345	G -> A	LOC_Os05g07260.3	downstream_gene_variant ; 1176.0bp to feature; MODIFIER	silent_mutation	Average:58.768; most accessible tissue: Zhenshan97 root, score: 72.671	N	N	N	N
vg0503844345	G -> A	LOC_Os05g07270.1	intron_variant ; MODIFIER	silent_mutation	Average:58.768; most accessible tissue: Zhenshan97 root, score: 72.671	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0503844345	NA	7.29E-09	mr1644	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503844345	NA	1.23E-14	mr1191_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503844345	2.83E-07	6.41E-08	mr1238_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503844345	1.70E-06	9.10E-07	mr1484_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503844345	6.61E-07	4.59E-08	mr1841_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503844345	NA	5.16E-21	mr1900_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503844345	NA	4.26E-06	mr1900_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251