Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0503844324:

Variant ID: vg0503844324 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 3844324
Reference Allele: T	Alternative Allele: G
Primary Allele: T	Secondary Allele: G

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.97, G: 0.03, others allele: 0.00, population size: 204. )

Flanking Sequence (100 bp) in Reference Genome:

GAATATATGCGGCTAATTAAAGAGGATATATATTGAATCATATGCAAGAGGAGGGCCAACTAGTTAATTAATGTGTTTCACCATCACATTATAGATTTCA[T/G]
AAGAGATGTACTAGGATTGTGGGAGTACTTCTCAATTTCGTTTTTTTTTAAAAAAAATGCACTTTTGAACATTAACTGTTGTCTTGAGCATAAACATGCA

Reverse complement sequence

TGCATGTTTATGCTCAAGACAACAGTTAATGTTCAAAAGTGCATTTTTTTTAAAAAAAAACGAAATTGAGAAGTACTCCCACAATCCTAGTACATCTCTT[A/C]
TGAAATCTATAATGTGATGGTGAAACACATTAATTAACTAGTTGGCCCTCCTCTTGCATATGATTCAATATATATCCTCTTTAATTAGCCGCATATATTC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	98.30%	1.70%	0.00%	0.00%	NA
All Indica	2759	99.90%	0.10%	0.00%	0.00%	NA
All Japonica	1512	99.70%	0.30%	0.00%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	100.00%	0.00%	0.00%	0.00%	NA
Indica III	913	99.90%	0.10%	0.00%	0.00%	NA
Indica Intermediate	786	99.90%	0.10%	0.00%	0.00%	NA
Temperate Japonica	767	99.90%	0.10%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	98.80%	1.20%	0.00%	0.00%	NA
VI/Aromatic	96	24.00%	76.00%	0.00%	0.00%	NA
Intermediate	90	97.80%	2.20%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0503844324	T -> G	LOC_Os05g07250.1	downstream_gene_variant ; 4994.0bp to feature; MODIFIER	silent_mutation	Average:64.786; most accessible tissue: Callus, score: 84.497	N	N	N	N
vg0503844324	T -> G	LOC_Os05g07260.1	downstream_gene_variant ; 1155.0bp to feature; MODIFIER	silent_mutation	Average:64.786; most accessible tissue: Callus, score: 84.497	N	N	N	N
vg0503844324	T -> G	LOC_Os05g07260.2	downstream_gene_variant ; 1166.0bp to feature; MODIFIER	silent_mutation	Average:64.786; most accessible tissue: Callus, score: 84.497	N	N	N	N
vg0503844324	T -> G	LOC_Os05g07260.4	downstream_gene_variant ; 1166.0bp to feature; MODIFIER	silent_mutation	Average:64.786; most accessible tissue: Callus, score: 84.497	N	N	N	N
vg0503844324	T -> G	LOC_Os05g07260.3	downstream_gene_variant ; 1155.0bp to feature; MODIFIER	silent_mutation	Average:64.786; most accessible tissue: Callus, score: 84.497	N	N	N	N
vg0503844324	T -> G	LOC_Os05g07270.1	intron_variant ; MODIFIER	silent_mutation	Average:64.786; most accessible tissue: Callus, score: 84.497	N	N	N	N