Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0503843930:

Variant ID: vg0503843930 (JBrowse)	Variation Type: INDEL
Chromosome: chr05	Position: 3843930
Reference Allele: TGCG	Alternative Allele: T,TGCGGCGGCG,TGCGGCG
Primary Allele: TGCG	Secondary Allele: TGCGGCGGCG

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ACGCGGCGGCGTACACCGCCGTCGTCGACGACGACGACGCCGATGCCGGCAGCGTCGCCGTCGTCACTACCCCCATGGTGCCAGCAACGGGCAGCTGGCG[TGCG/T,TGCGGCGGCG,TGCGGCG]
GCGGCGGCGGCGGCGAGGAGGTGCGAGGCGTGGGAGGAAGGGAGCACGGCGGCGGCGGAGGGGAGGCGGTACTTGTGCCTGACGATGTCGGCGCGGACGG

Reverse complement sequence

CCGTCCGCGCCGACATCGTCAGGCACAAGTACCGCCTCCCCTCCGCCGCCGCCGTGCTCCCTTCCTCCCACGCCTCGCACCTCCTCGCCGCCGCCGCCGC[CGCA/A,CGCCGCCGCA,CGCCGCA]
CGCCAGCTGCCCGTTGCTGGCACCATGGGGGTAGTGACGACGGCGACGCTGCCGGCATCGGCGTCGTCGTCGTCGACGACGGCGGTGTACGCCGCCGCGT

Allele Frequencies:

Populations	Population Size	Frequency of TGCG(primary allele)	Frequency of TGCGGCGGCG(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	99.60%	0.30%	0.04%	0.00%	TGCGGCG: 0.08%; T: 0.02%
All Indica	2759	99.40%	0.40%	0.07%	0.00%	TGCGGCG: 0.07%; T: 0.04%
All Japonica	1512	99.90%	0.00%	0.00%	0.00%	TGCGGCG: 0.13%
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	99.80%	0.00%	0.17%	0.00%	NA
Indica II	465	99.80%	0.00%	0.22%	0.00%	NA
Indica III	913	98.40%	1.30%	0.00%	0.00%	TGCGGCG: 0.22%; T: 0.11%
Indica Intermediate	786	100.00%	0.00%	0.00%	0.00%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	99.20%	0.00%	0.00%	0.00%	TGCGGCG: 0.83%
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	100.00%	0.00%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0503843930	TGCG -> T	LOC_Os05g07270.1	disruptive_inframe_deletion ; p.Ala156del; MODERATE	N	Average:83.238; most accessible tissue: Zhenshan97 root, score: 87.992	N	N	N	N
vg0503843930	TGCG -> T	LOC_Os05g07250.1	downstream_gene_variant ; 4601.0bp to feature; MODIFIER	N	Average:83.238; most accessible tissue: Zhenshan97 root, score: 87.992	N	N	N	N
vg0503843930	TGCG -> T	LOC_Os05g07260.1	downstream_gene_variant ; 762.0bp to feature; MODIFIER	N	Average:83.238; most accessible tissue: Zhenshan97 root, score: 87.992	N	N	N	N
vg0503843930	TGCG -> T	LOC_Os05g07260.2	downstream_gene_variant ; 773.0bp to feature; MODIFIER	N	Average:83.238; most accessible tissue: Zhenshan97 root, score: 87.992	N	N	N	N
vg0503843930	TGCG -> T	LOC_Os05g07260.4	downstream_gene_variant ; 773.0bp to feature; MODIFIER	N	Average:83.238; most accessible tissue: Zhenshan97 root, score: 87.992	N	N	N	N
vg0503843930	TGCG -> T	LOC_Os05g07260.3	downstream_gene_variant ; 762.0bp to feature; MODIFIER	N	Average:83.238; most accessible tissue: Zhenshan97 root, score: 87.992	N	N	N	N
vg0503843930	TGCG -> TGCGGCGGCG	LOC_Os05g07270.1	inframe_insertion ; p.Ala154_Ala155dup; MODERATE	N	Average:83.238; most accessible tissue: Zhenshan97 root, score: 87.992	N	N	N	N
vg0503843930	TGCG -> TGCGGCGGCG	LOC_Os05g07250.1	downstream_gene_variant ; 4604.0bp to feature; MODIFIER	N	Average:83.238; most accessible tissue: Zhenshan97 root, score: 87.992	N	N	N	N
vg0503843930	TGCG -> TGCGGCGGCG	LOC_Os05g07260.1	downstream_gene_variant ; 765.0bp to feature; MODIFIER	N	Average:83.238; most accessible tissue: Zhenshan97 root, score: 87.992	N	N	N	N
vg0503843930	TGCG -> TGCGGCGGCG	LOC_Os05g07260.2	downstream_gene_variant ; 776.0bp to feature; MODIFIER	N	Average:83.238; most accessible tissue: Zhenshan97 root, score: 87.992	N	N	N	N
vg0503843930	TGCG -> TGCGGCGGCG	LOC_Os05g07260.4	downstream_gene_variant ; 776.0bp to feature; MODIFIER	N	Average:83.238; most accessible tissue: Zhenshan97 root, score: 87.992	N	N	N	N
vg0503843930	TGCG -> TGCGGCGGCG	LOC_Os05g07260.3	downstream_gene_variant ; 765.0bp to feature; MODIFIER	N	Average:83.238; most accessible tissue: Zhenshan97 root, score: 87.992	N	N	N	N
vg0503843930	TGCG -> TGCGGCG	LOC_Os05g07270.1	inframe_insertion ; p.Ala155dup; MODERATE	N	Average:83.238; most accessible tissue: Zhenshan97 root, score: 87.992	N	N	N	N
vg0503843930	TGCG -> TGCGGCG	LOC_Os05g07250.1	downstream_gene_variant ; 4604.0bp to feature; MODIFIER	N	Average:83.238; most accessible tissue: Zhenshan97 root, score: 87.992	N	N	N	N
vg0503843930	TGCG -> TGCGGCG	LOC_Os05g07260.1	downstream_gene_variant ; 765.0bp to feature; MODIFIER	N	Average:83.238; most accessible tissue: Zhenshan97 root, score: 87.992	N	N	N	N
vg0503843930	TGCG -> TGCGGCG	LOC_Os05g07260.2	downstream_gene_variant ; 776.0bp to feature; MODIFIER	N	Average:83.238; most accessible tissue: Zhenshan97 root, score: 87.992	N	N	N	N
vg0503843930	TGCG -> TGCGGCG	LOC_Os05g07260.4	downstream_gene_variant ; 776.0bp to feature; MODIFIER	N	Average:83.238; most accessible tissue: Zhenshan97 root, score: 87.992	N	N	N	N
vg0503843930	TGCG -> TGCGGCG	LOC_Os05g07260.3	downstream_gene_variant ; 765.0bp to feature; MODIFIER	N	Average:83.238; most accessible tissue: Zhenshan97 root, score: 87.992	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0503843930	TGCG	T	0.1	-0.04	-0.04	-0.05	-0.07	-0.05
vg0503843930	TGCG	TGCGG*	0.11	0.03	0.0	0.06	0.08	0.2